Incidental Mutation 'R3765:Rab3il1'
ID274683
Institutional Source Beutler Lab
Gene Symbol Rab3il1
Ensembl Gene ENSMUSG00000024663
Gene NameRAB3A interacting protein (rabin3)-like 1
Synonyms1200014K04Rik, Rab3ail1
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3765 (G1)
Quality Score223
Status Not validated
Chromosome19
Chromosomal Location10001669-10038380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10028309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 87 (T87A)
Ref Sequence ENSEMBL: ENSMUSP00000113828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113161] [ENSMUST00000117641] [ENSMUST00000121418] [ENSMUST00000131407] [ENSMUST00000137637] [ENSMUST00000144788] [ENSMUST00000149967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113161
AA Change: T156A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108786
Gene: ENSMUSG00000024663
AA Change: T156A

DomainStartEndE-ValueType
Pfam:Sec2p 90 173 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117641
SMART Domains Protein: ENSMUSP00000113551
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 89 158 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121418
AA Change: T87A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663
AA Change: T87A

DomainStartEndE-ValueType
Pfam:Sec2p 20 129 4.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129882
Predicted Effect probably benign
Transcript: ENSMUST00000131407
SMART Domains Protein: ENSMUSP00000115976
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 86 7.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137637
SMART Domains Protein: ENSMUSP00000120366
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 58 5.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144788
AA Change: T156A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121449
Gene: ENSMUSG00000024663
AA Change: T156A

DomainStartEndE-ValueType
Pfam:Sec2p 89 198 4.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149967
SMART Domains Protein: ENSMUSP00000120401
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 51 3.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor for the ras-related protein Rab3A. The encoded protein binds Rab3a and the inositol hexakisphosphate kinase InsP6K1. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Rab3il1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Rab3il1 UTSW 19 10033751 missense probably damaging 1.00
R0324:Rab3il1 UTSW 19 10028289 missense probably damaging 1.00
R0613:Rab3il1 UTSW 19 10028364 missense probably damaging 1.00
R0648:Rab3il1 UTSW 19 10027388 small insertion probably benign
R3752:Rab3il1 UTSW 19 10030477 missense probably benign 0.05
R4062:Rab3il1 UTSW 19 10026624 missense probably benign
R4245:Rab3il1 UTSW 19 10030154 missense probably damaging 1.00
R4803:Rab3il1 UTSW 19 10027444 missense possibly damaging 0.78
R4820:Rab3il1 UTSW 19 10026670 missense probably benign 0.01
R7744:Rab3il1 UTSW 19 10028277 splice site probably null
R8047:Rab3il1 UTSW 19 10033802 missense probably benign 0.03
R8154:Rab3il1 UTSW 19 10027572 missense possibly damaging 0.83
R8812:Rab3il1 UTSW 19 10026777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAAGTTCCCAGATGCCG -3'
(R):5'- TGTGAGCCCACTATTGCAG -3'

Sequencing Primer
(F):5'- CTTCAGCAGAGTCTCACAATGTG -3'
(R):5'- GCCCACTATTGCAGCCTGTG -3'
Posted On2015-04-02