Incidental Mutation 'R3766:Itgav'
ID274691
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission 040743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3766 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 83801885 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000028499] [ENSMUST00000111740] [ENSMUST00000111740]
Predicted Effect probably null
Transcript: ENSMUST00000028499
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028499
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111740
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111740
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125402
SMART Domains Protein: ENSMUSP00000118016
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
SCOP:d1m1xa3 2 58 7e-19 SMART
PDB:3IJE|A 2 69 3e-41 PDB
low complexity region 71 84 N/A INTRINSIC
Pfam:Integrin_alpha 89 103 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131192
SMART Domains Protein: ENSMUSP00000121295
Gene: ENSMUSG00000027087

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Integrin_alpha 28 42 4.5e-9 PFAM
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C T 5: 125,506,262 T294M probably damaging Het
Brf2 G T 8: 27,124,468 T230N possibly damaging Het
Ccne2 A G 4: 11,199,293 probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Cttnbp2nl G A 3: 105,004,801 T589I probably benign Het
Dock10 A G 1: 80,536,926 S1091P probably damaging Het
Fh1 A G 1: 175,614,750 V178A probably damaging Het
Fndc1 A G 17: 7,784,421 S111P probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gm29394 C T 15: 58,048,628 probably benign Het
Herc2 A G 7: 56,163,824 D2601G probably damaging Het
Hspa13 T C 16: 75,765,086 D75G probably benign Het
Kif6 A T 17: 49,758,643 probably benign Het
Lypla1 G A 1: 4,840,978 R104Q probably benign Het
Map1b T C 13: 99,434,087 K709E unknown Het
Olfr504 G A 7: 108,565,195 P200L probably benign Het
Olfr685 A T 7: 105,180,881 I159K probably damaging Het
Pcdhb16 A T 18: 37,478,196 K70* probably null Het
Pex5l T G 3: 33,007,178 D174A probably benign Het
Plac8l1 A T 18: 42,180,395 M94K probably benign Het
Plxna1 T C 6: 89,334,775 probably benign Het
Psg26 T C 7: 18,475,071 T471A probably benign Het
Pus3 C A 9: 35,566,672 T400K probably benign Het
Pxk T C 14: 8,136,863 probably benign Het
Rapgef2 T C 3: 79,088,750 T569A probably benign Het
Sall4 T C 2: 168,756,044 Q292R possibly damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc45a1 T C 4: 150,638,060 R456G probably damaging Het
Sox13 T C 1: 133,390,798 R81G possibly damaging Het
Spag9 A G 11: 94,060,283 probably benign Het
Ston1 C T 17: 88,635,360 P65S probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Tcim T A 8: 24,438,749 R50W probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Trim59 A G 3: 69,036,804 V401A probably benign Het
Trpm3 A C 19: 22,448,377 Q32P probably benign Het
Tubgcp5 T A 7: 55,830,866 M1018K probably damaging Het
Ube2o A G 11: 116,546,863 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uvrag G T 7: 98,888,143 S615* probably null Het
Vmn2r6 T A 3: 64,556,508 I302L probably benign Het
Vmn2r73 C T 7: 85,871,990 V257I probably benign Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGTTACAAATGCCAGTGTGATC -3'
(R):5'- CAGGTATCCGTGCTCTGAAG -3'

Sequencing Primer
(F):5'- GATCTCACTGTGTAAGGAAATGGTC -3'
(R):5'- CTCTGAAGCCGGTGACTTACTAG -3'
Posted On2015-04-02