Incidental Mutation 'R3766:Tubgcp5'
ID274707
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission 040743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3766 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55830866 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1018 (M1018K)
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]
Predicted Effect probably damaging
Transcript: ENSMUST00000032627
AA Change: M1018K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: M1018K

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205311
Predicted Effect probably benign
Transcript: ENSMUST00000205796
AA Change: M955K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000206133
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Meta Mutation Damage Score 0.5877 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C T 5: 125,506,262 T294M probably damaging Het
Brf2 G T 8: 27,124,468 T230N possibly damaging Het
Ccne2 A G 4: 11,199,293 probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Cttnbp2nl G A 3: 105,004,801 T589I probably benign Het
Dock10 A G 1: 80,536,926 S1091P probably damaging Het
Fh1 A G 1: 175,614,750 V178A probably damaging Het
Fndc1 A G 17: 7,784,421 S111P probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gm29394 C T 15: 58,048,628 probably benign Het
Herc2 A G 7: 56,163,824 D2601G probably damaging Het
Hspa13 T C 16: 75,765,086 D75G probably benign Het
Itgav T C 2: 83,801,885 probably null Het
Kif6 A T 17: 49,758,643 probably benign Het
Lypla1 G A 1: 4,840,978 R104Q probably benign Het
Map1b T C 13: 99,434,087 K709E unknown Het
Olfr504 G A 7: 108,565,195 P200L probably benign Het
Olfr685 A T 7: 105,180,881 I159K probably damaging Het
Pcdhb16 A T 18: 37,478,196 K70* probably null Het
Pex5l T G 3: 33,007,178 D174A probably benign Het
Plac8l1 A T 18: 42,180,395 M94K probably benign Het
Plxna1 T C 6: 89,334,775 probably benign Het
Psg26 T C 7: 18,475,071 T471A probably benign Het
Pus3 C A 9: 35,566,672 T400K probably benign Het
Pxk T C 14: 8,136,863 probably benign Het
Rapgef2 T C 3: 79,088,750 T569A probably benign Het
Sall4 T C 2: 168,756,044 Q292R possibly damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc45a1 T C 4: 150,638,060 R456G probably damaging Het
Sox13 T C 1: 133,390,798 R81G possibly damaging Het
Spag9 A G 11: 94,060,283 probably benign Het
Ston1 C T 17: 88,635,360 P65S probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Tcim T A 8: 24,438,749 R50W probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Trim59 A G 3: 69,036,804 V401A probably benign Het
Trpm3 A C 19: 22,448,377 Q32P probably benign Het
Ube2o A G 11: 116,546,863 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uvrag G T 7: 98,888,143 S615* probably null Het
Vmn2r6 T A 3: 64,556,508 I302L probably benign Het
Vmn2r73 C T 7: 85,871,990 V257I probably benign Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55816562 missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTGTGTTCAATGGAAGGCTTTT -3'
(R):5'- CCAGGATAGTGAAATCTAAGACAATTT -3'

Sequencing Primer
(F):5'- TTCTGAGTTCAAGGACAGCC -3'
(R):5'- TTCTGAGCACCAGGTATGTAC -3'
Posted On2015-04-02