Incidental Mutation 'R3766:Uvrag'
ID274710
Institutional Source Beutler Lab
Gene Symbol Uvrag
Ensembl Gene ENSMUSG00000035354
Gene NameUV radiation resistance associated gene
Synonyms9530039D02Rik, Uvragl
MMRRC Submission 040743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3766 (G1)
Quality Score168
Status Validated
Chromosome7
Chromosomal Location98885021-99141141 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 98888143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 615 (S615*)
Ref Sequence ENSEMBL: ENSMUSP00000045297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037968]
Predicted Effect probably null
Transcript: ENSMUST00000037968
AA Change: S615*
SMART Domains Protein: ENSMUSP00000045297
Gene: ENSMUSG00000035354
AA Change: S615*

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
C2 42 147 1.43e-2 SMART
Pfam:Atg14 183 469 4.9e-21 PFAM
low complexity region 546 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207919
Predicted Effect probably benign
Transcript: ENSMUST00000209123
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon induced knock-out allele are viable and fertile but exhibit impaired autophagic flux, autophagosome accumulation in the heart, and age-related cardiomyopathy associated with compromised cardiac function and heart inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C T 5: 125,506,262 T294M probably damaging Het
Brf2 G T 8: 27,124,468 T230N possibly damaging Het
Ccne2 A G 4: 11,199,293 probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Cttnbp2nl G A 3: 105,004,801 T589I probably benign Het
Dock10 A G 1: 80,536,926 S1091P probably damaging Het
Fh1 A G 1: 175,614,750 V178A probably damaging Het
Fndc1 A G 17: 7,784,421 S111P probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Gm29394 C T 15: 58,048,628 probably benign Het
Herc2 A G 7: 56,163,824 D2601G probably damaging Het
Hspa13 T C 16: 75,765,086 D75G probably benign Het
Itgav T C 2: 83,801,885 probably null Het
Kif6 A T 17: 49,758,643 probably benign Het
Lypla1 G A 1: 4,840,978 R104Q probably benign Het
Map1b T C 13: 99,434,087 K709E unknown Het
Olfr504 G A 7: 108,565,195 P200L probably benign Het
Olfr685 A T 7: 105,180,881 I159K probably damaging Het
Pcdhb16 A T 18: 37,478,196 K70* probably null Het
Pex5l T G 3: 33,007,178 D174A probably benign Het
Plac8l1 A T 18: 42,180,395 M94K probably benign Het
Plxna1 T C 6: 89,334,775 probably benign Het
Psg26 T C 7: 18,475,071 T471A probably benign Het
Pus3 C A 9: 35,566,672 T400K probably benign Het
Pxk T C 14: 8,136,863 probably benign Het
Rapgef2 T C 3: 79,088,750 T569A probably benign Het
Sall4 T C 2: 168,756,044 Q292R possibly damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc45a1 T C 4: 150,638,060 R456G probably damaging Het
Sox13 T C 1: 133,390,798 R81G possibly damaging Het
Spag9 A G 11: 94,060,283 probably benign Het
Ston1 C T 17: 88,635,360 P65S probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Tcim T A 8: 24,438,749 R50W probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Trim59 A G 3: 69,036,804 V401A probably benign Het
Trpm3 A C 19: 22,448,377 Q32P probably benign Het
Tubgcp5 T A 7: 55,830,866 M1018K probably damaging Het
Ube2o A G 11: 116,546,863 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r6 T A 3: 64,556,508 I302L probably benign Het
Vmn2r73 C T 7: 85,871,990 V257I probably benign Het
Other mutations in Uvrag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Uvrag APN 7 98979741 missense probably damaging 0.99
IGL01085:Uvrag APN 7 99118224 missense probably damaging 1.00
IGL01362:Uvrag APN 7 98888513 missense probably benign 0.03
IGL01510:Uvrag APN 7 99004589 nonsense probably null
IGL02016:Uvrag APN 7 99099442 missense probably benign 0.06
IGL02164:Uvrag APN 7 99004689 nonsense probably null
IGL02170:Uvrag APN 7 99109090 nonsense probably null
IGL02836:Uvrag APN 7 98979777 missense possibly damaging 0.83
IGL02963:Uvrag APN 7 98906490 critical splice donor site probably null
PIT4651001:Uvrag UTSW 7 98906520 missense probably benign 0.23
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0304:Uvrag UTSW 7 98887973 missense probably benign 0.03
R0394:Uvrag UTSW 7 99004719 splice site probably benign
R0561:Uvrag UTSW 7 98888561 missense probably damaging 0.96
R1398:Uvrag UTSW 7 99065820 nonsense probably null
R1646:Uvrag UTSW 7 99118224 missense probably damaging 1.00
R1692:Uvrag UTSW 7 99004663 missense probably benign 0.02
R1760:Uvrag UTSW 7 98888348 missense probably benign 0.03
R1767:Uvrag UTSW 7 99099394 missense probably damaging 0.98
R2011:Uvrag UTSW 7 98939889 critical splice donor site probably null
R2484:Uvrag UTSW 7 98888461 missense probably benign 0.00
R3684:Uvrag UTSW 7 98988220 missense probably damaging 1.00
R3698:Uvrag UTSW 7 98939943 missense probably damaging 1.00
R3810:Uvrag UTSW 7 98979712 missense probably damaging 1.00
R4703:Uvrag UTSW 7 98989587 missense probably damaging 1.00
R5853:Uvrag UTSW 7 98888077 missense possibly damaging 0.80
R5896:Uvrag UTSW 7 98988207 nonsense probably null
R6185:Uvrag UTSW 7 99140832 critical splice donor site probably null
R6248:Uvrag UTSW 7 98988191 missense probably damaging 0.99
R6457:Uvrag UTSW 7 98906519 missense probably damaging 1.00
R6812:Uvrag UTSW 7 98888482 missense probably benign
R7451:Uvrag UTSW 7 99140913 missense unknown
R7724:Uvrag UTSW 7 98991963 missense probably benign 0.06
R7769:Uvrag UTSW 7 98979721 missense probably damaging 0.98
R8094:Uvrag UTSW 7 98991967 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCTCGCTGAGGGCATAGATC -3'
(R):5'- ACCTCCCTGGACTTCTCCAAAG -3'

Sequencing Primer
(F):5'- GCATAGATCCTGCGAGAGAACTC -3'
(R):5'- TGGACTTCTCCAAAGAAAACAAG -3'
Posted On2015-04-02