Incidental Mutation 'R3817:Tnfrsf11a'
ID274729
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R3817 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105809360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: T64I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: T64I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105844730 missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105844732 missense probably benign 0.02
R7614:Tnfrsf11a UTSW 1 105827369 missense probably damaging 1.00
R7651:Tnfrsf11a UTSW 1 105809446 missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
R7989:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCTGGATGAATGGTCCTG -3'
(R):5'- TGAGGAGAACCACTCAAAGC -3'

Sequencing Primer
(F):5'- GTCCTGTGAGTCAAATCTATAGGC -3'
(R):5'- GGGCATATTTAACAAGATCCTGTGG -3'
Posted On2015-04-02