Incidental Mutation 'R3817:Atp1b1'
ID 274731
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb-1, Atpb, sodium/potassium ATPase beta subunit
MMRRC Submission 040771-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R3817 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 164264678-164285924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 164270874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 35 (R35H)
Ref Sequence ENSEMBL: ENSMUSP00000141777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000193367]
AlphaFold P14094
Predicted Effect probably benign
Transcript: ENSMUST00000027863
AA Change: R91H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: R91H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193367
AA Change: R35H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576
AA Change: R35H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,088,934 (GRCm39) P369T probably damaging Het
B3galt2 G T 1: 143,522,811 (GRCm39) G316C probably damaging Het
Chd9 T C 8: 91,710,893 (GRCm39) probably benign Het
Clec4a4 A C 6: 122,967,366 (GRCm39) N14T probably damaging Het
Crb1 T A 1: 139,175,835 (GRCm39) Q716L probably benign Het
Cts7 T C 13: 61,504,350 (GRCm39) N71S probably damaging Het
Cyb561a3 T C 19: 10,559,728 (GRCm39) S18P possibly damaging Het
Cyp2c67 A T 19: 39,627,127 (GRCm39) F234L probably benign Het
Cyp4a12b A T 4: 115,289,667 (GRCm39) D178V probably damaging Het
Exph5 C T 9: 53,286,794 (GRCm39) Q1292* probably null Het
Gjb2 A G 14: 57,337,530 (GRCm39) V226A probably benign Het
Hivep2 T C 10: 14,019,685 (GRCm39) V2152A possibly damaging Het
Lig3 G A 11: 82,686,941 (GRCm39) V695M possibly damaging Het
Lrp1b T C 2: 40,766,670 (GRCm39) E2735G probably damaging Het
Lrrtm4 A G 6: 79,999,044 (GRCm39) E152G probably benign Het
Ly9 G T 1: 171,416,653 (GRCm39) T537N possibly damaging Het
Nav2 A G 7: 49,114,310 (GRCm39) T765A probably benign Het
Or5p59 A G 7: 107,702,705 (GRCm39) Y63C possibly damaging Het
Or8b12c C T 9: 37,715,465 (GRCm39) S86L probably benign Het
Or8b40 A T 9: 38,027,922 (GRCm39) T277S possibly damaging Het
Or8b55 A G 9: 38,727,722 (GRCm39) K308E possibly damaging Het
Or8g52 A G 9: 39,631,404 (GRCm39) N294D possibly damaging Het
Pomgnt1 T A 4: 116,011,139 (GRCm39) probably null Het
Ppp2r5c T C 12: 110,510,621 (GRCm39) probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Skint5 A G 4: 113,486,319 (GRCm39) probably benign Het
Slc27a1 T C 8: 72,037,122 (GRCm39) V422A probably damaging Het
Sorl1 A G 9: 41,975,345 (GRCm39) L487P possibly damaging Het
Tnfrsf11a C T 1: 105,737,085 (GRCm39) T64I probably damaging Het
Tns3 G C 11: 8,384,619 (GRCm39) R1400G probably damaging Het
Vmn2r19 A T 6: 123,286,601 (GRCm39) Y78F probably damaging Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Zfp672 G T 11: 58,207,462 (GRCm39) H286Q possibly damaging Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164,285,330 (GRCm39) missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164,265,918 (GRCm39) missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164,270,829 (GRCm39) missense probably benign
R1034:Atp1b1 UTSW 1 164,281,057 (GRCm39) critical splice donor site probably null
R1597:Atp1b1 UTSW 1 164,265,889 (GRCm39) missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164,281,084 (GRCm39) missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3819:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164,281,127 (GRCm39) missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164,265,867 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAGAATTCCGTGACATTGC -3'
(R):5'- TAATCCATCCCGTGAGCCAAG -3'

Sequencing Primer
(F):5'- TGCCTTTAAACTACTAAAGCAACGG -3'
(R):5'- CCGTGAGCCAAGTGGGAATG -3'
Posted On 2015-04-02