Incidental Mutation 'R3817:Lrrtm4'
ID274738
Institutional Source Beutler Lab
Gene Symbol Lrrtm4
Ensembl Gene ENSMUSG00000052581
Gene Nameleucine rich repeat transmembrane neuronal 4
Synonyms7530419J18Rik
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R3817 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location80018877-80810143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80022061 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 152 (E152G)
Ref Sequence ENSEMBL: ENSMUSP00000117263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074662] [ENSMUST00000126005] [ENSMUST00000126399] [ENSMUST00000128718] [ENSMUST00000133918] [ENSMUST00000136421] [ENSMUST00000145407] [ENSMUST00000147663]
Predicted Effect probably benign
Transcript: ENSMUST00000074662
AA Change: E151G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074232
Gene: ENSMUSG00000052581
AA Change: E151G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126005
AA Change: E151G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117445
Gene: ENSMUSG00000052581
AA Change: E151G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126399
AA Change: E151G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121124
Gene: ENSMUSG00000052581
AA Change: E151G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130734
Predicted Effect probably benign
Transcript: ENSMUST00000133918
AA Change: E151G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115016
Gene: ENSMUSG00000052581
AA Change: E151G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136421
AA Change: E152G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121621
Gene: ENSMUSG00000052581
AA Change: E152G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 4e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145407
SMART Domains Protein: ENSMUSP00000114465
Gene: ENSMUSG00000052581

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
Blast:LRR_TYP 84 104 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147663
AA Change: E152G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117263
Gene: ENSMUSG00000052581
AA Change: E152G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 2e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired excitatory synapse development and excitatory transmission in dentate gyrus granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Lrrtm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Lrrtm4 APN 6 80022546 missense probably damaging 1.00
IGL02043:Lrrtm4 APN 6 80021862 missense possibly damaging 0.89
IGL02603:Lrrtm4 APN 6 80022984 missense possibly damaging 0.92
IGL02614:Lrrtm4 APN 6 80021844 missense probably benign 0.01
IGL02735:Lrrtm4 APN 6 80809050 missense probably benign
IGL02812:Lrrtm4 APN 6 80021964 missense probably damaging 1.00
IGL02885:Lrrtm4 APN 6 80021803 missense probably damaging 1.00
IGL02956:Lrrtm4 APN 6 80021650 missense probably benign 0.04
IGL03242:Lrrtm4 APN 6 80022088 missense probably benign 0.22
R0504:Lrrtm4 UTSW 6 80022046 missense probably damaging 1.00
R0537:Lrrtm4 UTSW 6 80022120 missense probably benign 0.02
R0656:Lrrtm4 UTSW 6 80021970 missense possibly damaging 0.87
R0698:Lrrtm4 UTSW 6 80022928 missense probably damaging 1.00
R1651:Lrrtm4 UTSW 6 80022528 missense probably benign 0.06
R2126:Lrrtm4 UTSW 6 80021739 missense probably damaging 1.00
R2211:Lrrtm4 UTSW 6 80022640 missense probably benign 0.00
R2363:Lrrtm4 UTSW 6 80021874 missense probably damaging 1.00
R3732:Lrrtm4 UTSW 6 80019655 intron probably benign
R4814:Lrrtm4 UTSW 6 80023134 missense possibly damaging 0.69
R5304:Lrrtm4 UTSW 6 80022700 missense probably benign 0.01
R5318:Lrrtm4 UTSW 6 80022512 missense probably damaging 1.00
R5327:Lrrtm4 UTSW 6 80022637 missense probably damaging 1.00
R5931:Lrrtm4 UTSW 6 80021739 missense probably damaging 0.99
R6195:Lrrtm4 UTSW 6 80021956 missense probably damaging 1.00
R7597:Lrrtm4 UTSW 6 80022445 nonsense probably null
R7793:Lrrtm4 UTSW 6 80022858 missense probably damaging 0.97
R7875:Lrrtm4 UTSW 6 80022360 missense possibly damaging 0.89
R7958:Lrrtm4 UTSW 6 80022360 missense possibly damaging 0.89
R8058:Lrrtm4 UTSW 6 80022545 missense probably benign
Z1177:Lrrtm4 UTSW 6 80022717 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATCCAATCAGTTTGCCGGC -3'
(R):5'- CTCTTTTAACTTCAGAAGACCGGC -3'

Sequencing Primer
(F):5'- GGCCTTAACCAGCTTATATGGC -3'
(R):5'- CAAACGCGTTTCGGGATAAGC -3'
Posted On2015-04-02