Incidental Mutation 'R3817:Clec4a4'
ID 274739
Institutional Source Beutler Lab
Gene Symbol Clec4a4
Ensembl Gene ENSMUSG00000059639
Gene Name C-type lectin domain family 4, member a4
Synonyms Dcir2
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3817 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 122990367-123024105 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 122990407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 14 (N14T)
Ref Sequence ENSEMBL: ENSMUSP00000078351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079379]
AlphaFold Q5YIR8
PDB Structure Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 (apo form) [X-RAY DIFFRACTION]
Crystal structure of C-type lectin domain of murine dendritic cell inhibitory receptor 2 in complex with N-glycan [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000079379
AA Change: N14T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078351
Gene: ENSMUSG00000059639
AA Change: N14T

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 230 1.72e-32 SMART
Meta Mutation Damage Score 0.2238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Clec4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Clec4a4 APN 6 123024016 nonsense probably null
IGL01659:Clec4a4 APN 6 123023935 missense probably damaging 0.98
IGL02455:Clec4a4 APN 6 123013780 missense possibly damaging 0.94
IGL02726:Clec4a4 APN 6 122990379 missense probably damaging 0.99
IGL03241:Clec4a4 APN 6 122990373 missense probably damaging 0.99
R0751:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1184:Clec4a4 UTSW 6 123012712 missense probably benign 0.12
R1455:Clec4a4 UTSW 6 123012799 missense possibly damaging 0.60
R1474:Clec4a4 UTSW 6 123012744 missense probably benign 0.01
R1514:Clec4a4 UTSW 6 122990442 missense probably benign 0.26
R1779:Clec4a4 UTSW 6 123023975 missense probably damaging 1.00
R2138:Clec4a4 UTSW 6 123023978 missense probably damaging 0.99
R2182:Clec4a4 UTSW 6 123013757 critical splice acceptor site probably null
R2207:Clec4a4 UTSW 6 123013807 missense probably damaging 1.00
R5474:Clec4a4 UTSW 6 123012747 missense probably damaging 0.99
R5917:Clec4a4 UTSW 6 123004058 missense probably benign 0.25
R6164:Clec4a4 UTSW 6 122991874 missense possibly damaging 0.89
R6628:Clec4a4 UTSW 6 123012804 missense probably benign 0.23
R7212:Clec4a4 UTSW 6 122991745 splice site probably null
R7399:Clec4a4 UTSW 6 122991829 missense possibly damaging 0.86
R7808:Clec4a4 UTSW 6 122990380 missense probably damaging 0.96
R8370:Clec4a4 UTSW 6 122991799 missense probably damaging 1.00
R8515:Clec4a4 UTSW 6 123004023 missense probably benign 0.25
R8900:Clec4a4 UTSW 6 123023916 missense probably damaging 1.00
R8904:Clec4a4 UTSW 6 123013877 splice site probably benign
R9260:Clec4a4 UTSW 6 123023936 nonsense probably null
X0013:Clec4a4 UTSW 6 123023912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAGTGAGACATGCCTCTTC -3'
(R):5'- TGTCCAGCTCTTCAAGTTGATC -3'

Sequencing Primer
(F):5'- AGTGAGACATGCCTCTTCTTTCATAC -3'
(R):5'- TAAGACTCCAGTAAAATACCAGATGG -3'
Posted On 2015-04-02