Incidental Mutation 'R3817:Olfr483'
ID 274742
Institutional Source Beutler Lab
Gene Symbol Olfr483
Ensembl Gene ENSMUSG00000078118
Gene Name olfactory receptor 483
Synonyms MOR204-12, GA_x6K02T2PBJ9-10432095-10433042
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R3817 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108100849-108105944 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108103498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000150898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104917] [ENSMUST00000215159]
AlphaFold Q8VG05
Predicted Effect possibly damaging
Transcript: ENSMUST00000104917
AA Change: Y63C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100517
Gene: ENSMUSG00000078118
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 1.6e-51 PFAM
Pfam:7tm_1 44 294 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209740
AA Change: Y63C
Predicted Effect possibly damaging
Transcript: ENSMUST00000215159
AA Change: Y63C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.6721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Olfr483
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr483 APN 7 108103644 missense probably benign
IGL03028:Olfr483 APN 7 108104173 missense probably damaging 0.99
IGL03275:Olfr483 APN 7 108103608 missense probably damaging 1.00
R0671:Olfr483 UTSW 7 108104156 nonsense probably null
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1646:Olfr483 UTSW 7 108103591 missense probably benign 0.03
R1655:Olfr483 UTSW 7 108103464 missense probably damaging 1.00
R2334:Olfr483 UTSW 7 108103348 missense probably benign 0.02
R2904:Olfr483 UTSW 7 108103599 missense probably benign 0.12
R3816:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3818:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3819:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R5828:Olfr483 UTSW 7 108103798 missense possibly damaging 0.51
R5949:Olfr483 UTSW 7 108104197 missense probably damaging 1.00
R6120:Olfr483 UTSW 7 108104133 missense probably damaging 1.00
R6143:Olfr483 UTSW 7 108104128 missense probably damaging 0.96
R6505:Olfr483 UTSW 7 108103567 missense probably benign 0.00
R7718:Olfr483 UTSW 7 108103648 missense probably benign 0.00
R7946:Olfr483 UTSW 7 108103846 missense probably benign 0.10
R8138:Olfr483 UTSW 7 108103557 missense possibly damaging 0.73
R9248:Olfr483 UTSW 7 108104049 missense probably damaging 1.00
R9594:Olfr483 UTSW 7 108103456 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATGTGGCAGTGACTACAC -3'
(R):5'- AGCGATCATAAGCCATGGCAG -3'

Sequencing Primer
(F):5'- TTTCCTGCAGGATGGGAACC -3'
(R):5'- TGGCAGCCAAAAGGAAGCATTC -3'
Posted On 2015-04-02