Incidental Mutation 'R3817:Olfr889'
ID274746
Institutional Source Beutler Lab
Gene Symbol Olfr889
Ensembl Gene ENSMUSG00000096356
Gene Nameolfactory receptor 889
SynonymsMOR162-2, GA_x6K02T2PVTD-31795028-31795957
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3817 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38115198-38121245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38116626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 277 (T277S)
Ref Sequence ENSEMBL: ENSMUSP00000148913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072290] [ENSMUST00000217286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072290
AA Change: T282S

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072137
Gene: ENSMUSG00000096356
AA Change: T282S

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 4.4e-50 PFAM
Pfam:7tm_1 46 293 1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213042
AA Change: T277S
Predicted Effect possibly damaging
Transcript: ENSMUST00000217286
AA Change: T277S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Olfr889
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Olfr889 APN 9 38116597 missense probably benign 0.02
IGL02604:Olfr889 APN 9 38115852 nonsense probably null
IGL02727:Olfr889 APN 9 38116512 missense probably damaging 0.99
R0364:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R0387:Olfr889 UTSW 9 38115770 splice site probably null
R0409:Olfr889 UTSW 9 38116251 missense probably benign
R0515:Olfr889 UTSW 9 38116017 missense probably damaging 1.00
R0693:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R1554:Olfr889 UTSW 9 38115934 missense probably benign 0.01
R1972:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R1973:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R3815:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3816:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3819:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R5532:Olfr889 UTSW 9 38116627 missense probably benign 0.12
R5775:Olfr889 UTSW 9 38116127 missense probably damaging 1.00
R5931:Olfr889 UTSW 9 38116374 missense probably benign 0.00
R6458:Olfr889 UTSW 9 38116054 missense possibly damaging 0.90
R6751:Olfr889 UTSW 9 38115975 missense probably damaging 1.00
R7168:Olfr889 UTSW 9 38116663 missense probably damaging 1.00
R7673:Olfr889 UTSW 9 38116227 missense probably benign 0.00
R7698:Olfr889 UTSW 9 38115892 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTCCTGCACAAGTACC -3'
(R):5'- ACCGCTCTTGCAGATATGAC -3'

Sequencing Primer
(F):5'- GTACCTACATCAATGAGCTGGTAG -3'
(R):5'- CCGCTCTTGCAGATATGACATAGG -3'
Posted On2015-04-02