Incidental Mutation 'R3817:Ppp2r5c'
ID274757
Institutional Source Beutler Lab
Gene Symbol Ppp2r5c
Ensembl Gene ENSMUSG00000017843
Gene Nameprotein phosphatase 2, regulatory subunit B', gamma
Synonyms2700063L20Rik, 2610043M05Rik, Band 8A, D12Bwg0916e, B56/PP2A gamma
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3817 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110447120-110583062 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 110544187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084985] [ENSMUST00000084985] [ENSMUST00000084985] [ENSMUST00000084985] [ENSMUST00000109832] [ENSMUST00000109832] [ENSMUST00000109832] [ENSMUST00000109832] [ENSMUST00000220509] [ENSMUST00000220509] [ENSMUST00000221074] [ENSMUST00000221074] [ENSMUST00000221715] [ENSMUST00000221715]
Predicted Effect probably null
Transcript: ENSMUST00000084985
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084985
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084985
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084985
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109832
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109832
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109832
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109832
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220509
Predicted Effect probably null
Transcript: ENSMUST00000220509
Predicted Effect probably null
Transcript: ENSMUST00000221074
Predicted Effect probably null
Transcript: ENSMUST00000221074
Predicted Effect probably null
Transcript: ENSMUST00000221715
Predicted Effect probably null
Transcript: ENSMUST00000221715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223168
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele show partial neonatal lethality, hypoactivity, and abnormal ventricular septum formation associated with increased fetal cardiomyocyte apoptosis. Surviving homozygotes develop obesity and show an abnormal gait, decreased grip strength, and impaired balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Ppp2r5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ppp2r5c APN 12 110567827 missense probably benign 0.09
IGL01743:Ppp2r5c APN 12 110580434 missense probably benign 0.00
IGL01866:Ppp2r5c APN 12 110567827 missense probably benign 0.24
IGL02883:Ppp2r5c APN 12 110522563 missense possibly damaging 0.48
IGL02944:Ppp2r5c APN 12 110567800 missense probably benign 0.02
Cranraisin UTSW 12 110544145 missense probably damaging 1.00
FR4976:Ppp2r5c UTSW 12 110540738 intron probably null
R0020:Ppp2r5c UTSW 12 110574823 nonsense probably null
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0456:Ppp2r5c UTSW 12 110522579 missense probably damaging 0.99
R1521:Ppp2r5c UTSW 12 110554886 missense probably damaging 1.00
R1697:Ppp2r5c UTSW 12 110545623 nonsense probably null
R1697:Ppp2r5c UTSW 12 110561472 splice site probably benign
R2248:Ppp2r5c UTSW 12 110485923 missense probably benign 0.00
R4491:Ppp2r5c UTSW 12 110580522 missense possibly damaging 0.69
R5575:Ppp2r5c UTSW 12 110552832 missense probably damaging 1.00
R5828:Ppp2r5c UTSW 12 110570700 missense probably benign 0.01
R6059:Ppp2r5c UTSW 12 110574788 missense probably benign
R6351:Ppp2r5c UTSW 12 110554879 missense probably damaging 1.00
R6807:Ppp2r5c UTSW 12 110569022 missense possibly damaging 0.80
R6976:Ppp2r5c UTSW 12 110544145 missense probably damaging 1.00
R7236:Ppp2r5c UTSW 12 110465889 missense probably benign 0.01
R7360:Ppp2r5c UTSW 12 110574838 missense probably benign
R7363:Ppp2r5c UTSW 12 110522607 missense probably benign 0.01
R7467:Ppp2r5c UTSW 12 110552883 missense probably damaging 1.00
R7948:Ppp2r5c UTSW 12 110465986 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGTGGGAAGCATCTGTCAC -3'
(R):5'- TGGGTCCATAAAATCAGCCTATC -3'

Sequencing Primer
(F):5'- GCATCTGTCACTAGGATTATTCAGTG -3'
(R):5'- TCAGCCTATCAATAACTCACAAAC -3'
Posted On2015-04-02