Incidental Mutation 'R3817:Cts7'
ID274758
Institutional Source Beutler Lab
Gene Symbol Cts7
Ensembl Gene ENSMUSG00000021440
Gene Namecathepsin 7
SynonymsEpcs24, Epcs71, CTS1
MMRRC Submission 040771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R3817 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61352461-61358197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61356536 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 71 (N71S)
Ref Sequence ENSEMBL: ENSMUSP00000153603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021892] [ENSMUST00000224773] [ENSMUST00000224986] [ENSMUST00000225321]
Predicted Effect probably damaging
Transcript: ENSMUST00000021892
AA Change: N71S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021892
Gene: ENSMUSG00000021440
AA Change: N71S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 2.02e-15 SMART
Pept_C1 112 330 6.25e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224773
AA Change: N71S

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000224986
AA Change: N71S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225321
AA Change: N71S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appbp2 G T 11: 85,198,108 P369T probably damaging Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
B3galt2 G T 1: 143,647,073 G316C probably damaging Het
Chd9 T C 8: 90,984,265 probably benign Het
Clec4a4 A C 6: 122,990,407 N14T probably damaging Het
Crb1 T A 1: 139,248,097 Q716L probably benign Het
Cyb561a3 T C 19: 10,582,364 S18P possibly damaging Het
Cyp2c67 A T 19: 39,638,683 F234L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Exph5 C T 9: 53,375,494 Q1292* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Lig3 G A 11: 82,796,115 V695M possibly damaging Het
Lrp1b T C 2: 40,876,658 E2735G probably damaging Het
Lrrtm4 A G 6: 80,022,061 E152G probably benign Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Nav2 A G 7: 49,464,562 T765A probably benign Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Olfr965 A G 9: 39,720,108 N294D possibly damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp2r5c T C 12: 110,544,187 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc27a1 T C 8: 71,584,478 V422A probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Tns3 G C 11: 8,434,619 R1400G probably damaging Het
Vmn2r19 A T 6: 123,309,642 Y78F probably damaging Het
Wdr37 A G 13: 8,853,596 probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Cts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Cts7 APN 13 61356909 critical splice donor site probably null
IGL01954:Cts7 APN 13 61352823 missense probably benign 0.06
IGL01973:Cts7 APN 13 61355600 missense probably benign 0.02
IGL02098:Cts7 APN 13 61356529 missense probably damaging 1.00
IGL02716:Cts7 APN 13 61356608 missense probably benign 0.01
IGL02903:Cts7 APN 13 61356626 splice site probably benign
IGL03351:Cts7 APN 13 61356603 missense probably damaging 1.00
PIT4305001:Cts7 UTSW 13 61356572 missense probably damaging 1.00
R0691:Cts7 UTSW 13 61355734 missense probably damaging 1.00
R1168:Cts7 UTSW 13 61353817 missense probably damaging 0.99
R1711:Cts7 UTSW 13 61352810 missense probably damaging 1.00
R2352:Cts7 UTSW 13 61352772 nonsense probably null
R2442:Cts7 UTSW 13 61355617 nonsense probably null
R5513:Cts7 UTSW 13 61355584 missense possibly damaging 0.70
R5870:Cts7 UTSW 13 61355731 missense probably damaging 0.99
R6286:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6288:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6479:Cts7 UTSW 13 61355641 missense probably benign 0.00
R6653:Cts7 UTSW 13 61355003 missense probably damaging 1.00
R6721:Cts7 UTSW 13 61356294 missense probably damaging 1.00
R7246:Cts7 UTSW 13 61355580 missense probably damaging 0.99
R7644:Cts7 UTSW 13 61356968 nonsense probably null
R7939:Cts7 UTSW 13 61356550 missense probably damaging 1.00
R8336:Cts7 UTSW 13 61356909 critical splice donor site probably null
Z1177:Cts7 UTSW 13 61355632 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGCACTGGAGTCACATAGC -3'
(R):5'- TGCATATCTGTAGCAGCTAGTCC -3'

Sequencing Primer
(F):5'- ACTGGAGTCACATAGCCTTCC -3'
(R):5'- TGTAGCAGCTAGTCCACATG -3'
Posted On2015-04-02