Mutagenetix > Incidental Mutations

Incidental Mutation 'R3817:Cyp2c67'

274761

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

040771-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 39638683 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 234 (F234L)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

Predicted Effect

probably benign
Transcript: ENSMUST00000067328
AA Change: F234L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: F234L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (34/34)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Appbp2	G	T	11: 85,198,108	P369T	probably damaging	Het
Atp1b1	C	T	1: 164,443,305	R35H	probably benign	Het
B3galt2	G	T	1: 143,647,073	G316C	probably damaging	Het
Chd9	T	C	8: 90,984,265		probably benign	Het
Clec4a4	A	C	6: 122,990,407	N14T	probably damaging	Het
Crb1	T	A	1: 139,248,097	Q716L	probably benign	Het
Cts7	T	C	13: 61,356,536	N71S	probably damaging	Het
Cyb561a3	T	C	19: 10,582,364	S18P	possibly damaging	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Exph5	C	T	9: 53,375,494	Q1292*	probably null	Het
Gjb2	A	G	14: 57,100,073	V226A	probably benign	Het
Hivep2	T	C	10: 14,143,941	V2152A	possibly damaging	Het
Lig3	G	A	11: 82,796,115	V695M	possibly damaging	Het
Lrp1b	T	C	2: 40,876,658	E2735G	probably damaging	Het
Lrrtm4	A	G	6: 80,022,061	E152G	probably benign	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Nav2	A	G	7: 49,464,562	T765A	probably benign	Het
Olfr483	A	G	7: 108,103,498	Y63C	possibly damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Olfr965	A	G	9: 39,720,108	N294D	possibly damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Ppp2r5c	T	C	12: 110,544,187		probably null	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Slc27a1	T	C	8: 71,584,478	V422A	probably damaging	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Tnfrsf11a	C	T	1: 105,809,360	T64I	probably damaging	Het
Tns3	G	C	11: 8,434,619	R1400G	probably damaging	Het
Vmn2r19	A	T	6: 123,309,642	Y78F	probably damaging	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het
Zfp672	G	T	11: 58,316,636	H286Q	possibly damaging	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0975:Cyp2c67	UTSW	19	39609178	missense	possibly damaging	0.49
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1505:Cyp2c67	UTSW	19	39648964	missense	probably benign	0.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R2181:Cyp2c67	UTSW	19	39609097	missense	possibly damaging	0.94
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5345:Cyp2c67	UTSW	19	39626232	missense	probably benign	0.01
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6939:Cyp2c67	UTSW	19	39643334	missense	possibly damaging	0.68
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATGAACTCTACAGTCCATGACAAG -3'
(R):5'- GGTTATTCAAACGTGTAGAACAGAG -3'

Sequencing Primer
(F):5'- AGTCCATGACAAGTCCATAATTTTAG -3'
(R):5'- ACACTCAAAAGATATGTGAGTGTG -3'

Posted On

2015-04-02