Incidental Mutation 'R3818:Tnfrsf11a'
ID 274764
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Name tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms TRANCE-R, Rank
MMRRC Submission 040772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R3818 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 105708443-105775709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105737085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
AlphaFold O35305
PDB Structure Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: T64I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: T64I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187812
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T C 10: 80,155,351 (GRCm39) D54G probably damaging Het
Adra2b G T 2: 127,205,755 (GRCm39) E86* probably null Het
Cachd1 A T 4: 100,848,062 (GRCm39) D1059V probably damaging Het
Cd177 A G 7: 24,453,817 (GRCm39) V358A probably benign Het
Col25a1 A G 3: 130,343,720 (GRCm39) K396R possibly damaging Het
Csmd1 C T 8: 16,052,522 (GRCm39) A2201T probably damaging Het
Cyp4a12b A T 4: 115,289,667 (GRCm39) D178V probably damaging Het
Cyp4a30b G T 4: 115,316,206 (GRCm39) A311S probably damaging Het
Dse T C 10: 34,029,429 (GRCm39) I554V probably benign Het
Gabrg3 G A 7: 57,031,412 (GRCm39) Q43* probably null Het
Gjb2 A G 14: 57,337,530 (GRCm39) V226A probably benign Het
Gpr21 C A 2: 37,408,324 (GRCm39) T290N probably damaging Het
Gsdme A C 6: 50,196,391 (GRCm39) S340A probably benign Het
Hivep2 T C 10: 14,019,685 (GRCm39) V2152A possibly damaging Het
Mamdc4 C T 2: 25,455,785 (GRCm39) S840N probably benign Het
Or5p59 A G 7: 107,702,705 (GRCm39) Y63C possibly damaging Het
Or8i2 G A 2: 86,852,054 (GRCm39) T278I probably benign Het
Pah A G 10: 87,357,866 (GRCm39) probably benign Het
Pikfyve T A 1: 65,284,917 (GRCm39) S794T probably damaging Het
Plekhn1 T C 4: 156,309,990 (GRCm39) H108R probably damaging Het
Pomgnt1 T A 4: 116,011,139 (GRCm39) probably null Het
Prkd1 A T 12: 50,466,667 (GRCm39) probably benign Het
Pwp1 C T 10: 85,723,993 (GRCm39) P498L possibly damaging Het
Rasa4 A G 5: 136,131,147 (GRCm39) T414A possibly damaging Het
Rbm26 A T 14: 105,378,706 (GRCm39) L594I probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Skint5 A G 4: 113,486,319 (GRCm39) probably benign Het
Sorcs3 A G 19: 48,592,343 (GRCm39) N336S probably benign Het
Sspo A T 6: 48,458,037 (GRCm39) E3269V possibly damaging Het
Tlr4 A G 4: 66,759,553 (GRCm39) E782G probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttl T C 2: 128,934,914 (GRCm39) V358A probably damaging Het
Wdhd1 A G 14: 47,481,258 (GRCm39) probably null Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Zfp939 T C 7: 39,122,792 (GRCm39) noncoding transcript Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105,737,147 (GRCm39) missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105,755,443 (GRCm39) missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105,749,215 (GRCm39) missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105,749,215 (GRCm39) missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105,749,242 (GRCm39) missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105,772,583 (GRCm39) nonsense probably null
R0514:Tnfrsf11a UTSW 1 105,754,717 (GRCm39) missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105,735,880 (GRCm39) missense unknown
R1470:Tnfrsf11a UTSW 1 105,752,773 (GRCm39) missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105,752,773 (GRCm39) missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105,772,431 (GRCm39) missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105,754,786 (GRCm39) missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105,737,130 (GRCm39) missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105,737,085 (GRCm39) missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105,755,464 (GRCm39) splice site probably null
R4039:Tnfrsf11a UTSW 1 105,755,464 (GRCm39) splice site probably null
R4238:Tnfrsf11a UTSW 1 105,754,962 (GRCm39) missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105,741,545 (GRCm39) splice site probably null
R6102:Tnfrsf11a UTSW 1 105,747,671 (GRCm39) missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105,772,272 (GRCm39) missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105,772,421 (GRCm39) missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105,755,264 (GRCm39) missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105,735,866 (GRCm39) critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105,772,456 (GRCm39) missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105,772,458 (GRCm39) missense probably benign 0.02
R7614:Tnfrsf11a UTSW 1 105,755,094 (GRCm39) missense probably damaging 1.00
R7651:Tnfrsf11a UTSW 1 105,737,171 (GRCm39) missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105,737,099 (GRCm39) missense probably damaging 1.00
R8078:Tnfrsf11a UTSW 1 105,745,409 (GRCm39) missense probably damaging 1.00
R8364:Tnfrsf11a UTSW 1 105,745,412 (GRCm39) missense probably damaging 0.99
R8859:Tnfrsf11a UTSW 1 105,772,244 (GRCm39) critical splice acceptor site probably null
R8979:Tnfrsf11a UTSW 1 105,754,825 (GRCm39) missense possibly damaging 0.78
R9008:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9016:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9017:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
R9052:Tnfrsf11a UTSW 1 105,754,854 (GRCm39) missense possibly damaging 0.92
Z1177:Tnfrsf11a UTSW 1 105,754,724 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGATGAATGGTCCTGTG -3'
(R):5'- TTTAACCTGAGGCACTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGTGAGTCAAATCTATAGGC -3'
(R):5'- GGGCATATTTAACAAGATCCTGTGG -3'
Posted On 2015-04-02