Incidental Mutation 'R3819:Atp1b1'
ID274800
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene NameATPase, Na+/K+ transporting, beta 1 polypeptide
SynonymsAtpb, Atpb-1, sodium/potassium ATPase beta subunit
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164437109-164458355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164443305 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 35 (R35H)
Ref Sequence ENSEMBL: ENSMUSP00000141777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000193367]
Predicted Effect probably benign
Transcript: ENSMUST00000027863
AA Change: R91H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: R91H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193367
AA Change: R35H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576
AA Change: R35H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164457761 missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164438349 missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164443260 missense probably benign
R1034:Atp1b1 UTSW 1 164453488 critical splice donor site probably null
R1597:Atp1b1 UTSW 1 164438320 missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164453515 missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164453558 missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164438298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAGAATTCCGTGACATTGC -3'
(R):5'- AATCCATCCCGTGAGCCAAG -3'

Sequencing Primer
(F):5'- TGCCTTTAAACTACTAAAGCAACGG -3'
(R):5'- CCGTGAGCCAAGTGGGAATG -3'
Posted On2015-04-02