Incidental Mutation 'R3819:Atp1b1'
ID 274800
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb-1, Atpb, sodium/potassium ATPase beta subunit
MMRRC Submission 040773-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R3819 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 164264678-164285924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 164270874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 35 (R35H)
Ref Sequence ENSEMBL: ENSMUSP00000141777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000193367]
AlphaFold P14094
Predicted Effect probably benign
Transcript: ENSMUST00000027863
AA Change: R91H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: R91H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193367
AA Change: R35H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576
AA Change: R35H

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,936,024 (GRCm39) probably benign Het
Barx1 T C 13: 48,818,960 (GRCm39) I200T possibly damaging Het
Coil T C 11: 88,872,619 (GRCm39) F380L probably benign Het
Csmd1 C T 8: 16,052,522 (GRCm39) A2201T probably damaging Het
Dab2ip T C 2: 35,603,222 (GRCm39) C417R probably damaging Het
Dhx57 A G 17: 80,572,503 (GRCm39) probably null Het
Gabrg3 G A 7: 57,031,412 (GRCm39) Q43* probably null Het
Gbp7 C A 3: 142,249,826 (GRCm39) H432Q possibly damaging Het
Gjb2 A G 14: 57,337,530 (GRCm39) V226A probably benign Het
Gsdme A C 6: 50,196,391 (GRCm39) S340A probably benign Het
Hivep2 T C 10: 14,019,685 (GRCm39) V2152A possibly damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Krt34 T C 11: 99,930,844 (GRCm39) E186G probably damaging Het
Ly9 G T 1: 171,416,653 (GRCm39) T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 (GRCm39) K321E probably damaging Het
Or5ac22 A G 16: 59,135,434 (GRCm39) F112S probably damaging Het
Or5p59 A G 7: 107,702,705 (GRCm39) Y63C possibly damaging Het
Or8b12c C T 9: 37,715,465 (GRCm39) S86L probably benign Het
Or8b40 A T 9: 38,027,922 (GRCm39) T277S possibly damaging Het
Or8b55 A G 9: 38,727,722 (GRCm39) K308E possibly damaging Het
Paxbp1 A C 16: 90,819,640 (GRCm39) probably benign Het
Plcl1 T A 1: 55,735,758 (GRCm39) D366E probably benign Het
Pramel22 T A 4: 143,382,365 (GRCm39) E110D probably benign Het
Prdm5 T C 6: 65,913,041 (GRCm39) F391L possibly damaging Het
Rasef C G 4: 73,677,942 (GRCm39) D95H probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Skint3 A T 4: 112,113,085 (GRCm39) I232F possibly damaging Het
Slc43a3 T C 2: 84,774,896 (GRCm39) I158T probably damaging Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Sorl1 A G 9: 41,975,345 (GRCm39) L487P possibly damaging Het
Sspo A T 6: 48,458,037 (GRCm39) E3269V possibly damaging Het
Stat3 C T 11: 100,789,459 (GRCm39) S377N probably damaging Het
Tbpl2 A G 2: 23,966,024 (GRCm39) V321A probably damaging Het
Tnfrsf11a C T 1: 105,737,085 (GRCm39) T64I probably damaging Het
Ttn T C 2: 76,729,047 (GRCm39) probably benign Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Xdh A T 17: 74,213,720 (GRCm39) I811K probably benign Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164,285,330 (GRCm39) missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164,265,918 (GRCm39) missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164,270,829 (GRCm39) missense probably benign
R1034:Atp1b1 UTSW 1 164,281,057 (GRCm39) critical splice donor site probably null
R1597:Atp1b1 UTSW 1 164,265,889 (GRCm39) missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164,281,084 (GRCm39) missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164,281,127 (GRCm39) missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164,265,867 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGAGAATTCCGTGACATTGC -3'
(R):5'- AATCCATCCCGTGAGCCAAG -3'

Sequencing Primer
(F):5'- TGCCTTTAAACTACTAAAGCAACGG -3'
(R):5'- CCGTGAGCCAAGTGGGAATG -3'
Posted On 2015-04-02