Incidental Mutation 'R3819:Ly9'
ID274801
Institutional Source Beutler Lab
Gene Symbol Ly9
Ensembl Gene ENSMUSG00000004707
Gene Namelymphocyte antigen 9
SynonymsT100, CD229, Lgp100, SLAMF3
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171588624-171607410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 171589085 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 537 (T537N)
Ref Sequence ENSEMBL: ENSMUSP00000004827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004827] [ENSMUST00000004829] [ENSMUST00000068878] [ENSMUST00000111277] [ENSMUST00000143463] [ENSMUST00000194797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004827
AA Change: T537N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004827
Gene: ENSMUSG00000004707
AA Change: T537N

DomainStartEndE-ValueType
Pfam:Ig_3 46 116 7.9e-9 PFAM
Pfam:Ig_2 46 129 5.4e-10 PFAM
IG 143 246 1.49e-2 SMART
Pfam:Ig_3 251 320 4.1e-13 PFAM
Pfam:Ig_2 251 330 7.5e-6 PFAM
transmembrane domain 345 364 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004829
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068878
AA Change: T647N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069319
Gene: ENSMUSG00000004707
AA Change: T647N

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 5.6e-8 PFAM
Pfam:Ig_2 156 239 4e-8 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5.4e-10 PFAM
low complexity region 433 441 N/A INTRINSIC
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111277
SMART Domains Protein: ENSMUSP00000106908
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 9.9e-9 PFAM
Pfam:Ig_2 156 239 6.8e-10 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5e-13 PFAM
Pfam:Ig_2 361 440 9.4e-6 PFAM
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143463
SMART Domains Protein: ENSMUSP00000137924
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195804
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: This locus controls an antigen on thymocytes, lymphocytes and bone marrow cells. The a allele determines Ly9.1 antigen in A/J, 129/Re, BALB/c and C3H/He; the b allele determines antigen Ly9.2 in the C57 family of strains, HTI/Go, MA/My, F/St and C58/Lw. Null mutants are viable, healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Ly9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ly9 APN 1 171593451 missense probably damaging 1.00
IGL00640:Ly9 APN 1 171601879 missense possibly damaging 0.65
IGL01899:Ly9 APN 1 171607247 missense probably damaging 0.99
IGL02714:Ly9 APN 1 171605118 missense possibly damaging 0.60
IGL03086:Ly9 APN 1 171605170 missense probably benign 0.01
R0647:Ly9 UTSW 1 171599808 missense probably damaging 1.00
R1292:Ly9 UTSW 1 171589103 unclassified probably null
R1422:Ly9 UTSW 1 171601212 missense probably damaging 1.00
R1598:Ly9 UTSW 1 171596507 missense probably benign 0.03
R1985:Ly9 UTSW 1 171599773 missense probably damaging 1.00
R2219:Ly9 UTSW 1 171597681 splice site probably null
R2427:Ly9 UTSW 1 171607232 missense probably damaging 0.99
R3764:Ly9 UTSW 1 171594144 missense possibly damaging 0.92
R3815:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3816:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3817:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R4590:Ly9 UTSW 1 171593875 nonsense probably null
R4653:Ly9 UTSW 1 171594029 missense probably benign 0.41
R4755:Ly9 UTSW 1 171607238 missense probably damaging 0.99
R4871:Ly9 UTSW 1 171607330 intron probably benign
R5167:Ly9 UTSW 1 171605205 missense probably damaging 1.00
R5203:Ly9 UTSW 1 171599779 missense probably damaging 1.00
R5270:Ly9 UTSW 1 171601162 missense probably damaging 0.99
R5692:Ly9 UTSW 1 171605187 frame shift probably null
R5996:Ly9 UTSW 1 171601828 missense probably damaging 1.00
R6389:Ly9 UTSW 1 171596537 missense probably damaging 1.00
R6391:Ly9 UTSW 1 171601008 missense possibly damaging 0.76
R6457:Ly9 UTSW 1 171589095 missense probably damaging 1.00
R6730:Ly9 UTSW 1 171605169 missense probably benign 0.14
R6732:Ly9 UTSW 1 171594085 missense possibly damaging 0.74
R6862:Ly9 UTSW 1 171601155 missense probably benign 0.21
R6866:Ly9 UTSW 1 171605279 missense probably damaging 0.99
R7455:Ly9 UTSW 1 171593939 nonsense probably null
X0062:Ly9 UTSW 1 171605221 missense possibly damaging 0.82
Z1176:Ly9 UTSW 1 171594060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTGACCTGTGAATGG -3'
(R):5'- AGCACATGGTCCTTAGCACTG -3'

Sequencing Primer
(F):5'- ACCTGTGAATGGGCTCATG -3'
(R):5'- ATGGTCCTTAGCACTGGGACTC -3'
Posted On2015-04-02