Incidental Mutation 'R3819:Tbpl2'
ID274802
Institutional Source Beutler Lab
Gene Symbol Tbpl2
Ensembl Gene ENSMUSG00000061809
Gene NameTATA box binding protein like 2
SynonymsLOC227606, Trf3
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24071721-24096595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24076012 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 321 (V321A)
Ref Sequence ENSEMBL: ENSMUSP00000120310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080453] [ENSMUST00000153338]
Predicted Effect probably damaging
Transcript: ENSMUST00000080453
AA Change: V323A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079309
Gene: ENSMUSG00000061809
AA Change: V323A

DomainStartEndE-ValueType
Pfam:TBP 173 255 1.2e-33 PFAM
Pfam:TBP 263 347 1.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153338
AA Change: V321A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120310
Gene: ENSMUSG00000061809
AA Change: V321A

DomainStartEndE-ValueType
Pfam:TBP 171 255 3.1e-34 PFAM
Pfam:TBP 260 346 8.3e-36 PFAM
Meta Mutation Damage Score 0.6814 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit infertility due to impaired folliculogenesis before or during secondary follicle development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Tbpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Tbpl2 APN 2 24094973 missense probably benign 0.08
IGL02273:Tbpl2 APN 2 24096519 missense probably benign 0.00
IGL02887:Tbpl2 APN 2 24093876 missense probably damaging 0.99
IGL02969:Tbpl2 APN 2 24091093 missense probably damaging 1.00
IGL03075:Tbpl2 APN 2 24071985 utr 3 prime probably benign
IGL03107:Tbpl2 APN 2 24093833 missense probably benign 0.01
IGL03118:Tbpl2 APN 2 24087289 missense probably benign 0.22
R0322:Tbpl2 UTSW 2 24094979 missense probably benign 0.00
R1208:Tbpl2 UTSW 2 24094771 missense probably benign 0.02
R1208:Tbpl2 UTSW 2 24094771 missense probably benign 0.02
R1699:Tbpl2 UTSW 2 24095045 missense probably benign 0.00
R1987:Tbpl2 UTSW 2 24094732 missense probably benign
R2040:Tbpl2 UTSW 2 24094859 missense probably benign 0.00
R3500:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R3937:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R4995:Tbpl2 UTSW 2 24093860 missense possibly damaging 0.94
R5033:Tbpl2 UTSW 2 24087158 missense probably benign 0.01
R5606:Tbpl2 UTSW 2 24087233 missense possibly damaging 0.67
R6049:Tbpl2 UTSW 2 24094992 missense possibly damaging 0.75
R6153:Tbpl2 UTSW 2 24076016 missense probably damaging 1.00
R6260:Tbpl2 UTSW 2 24094886 missense possibly damaging 0.94
R6347:Tbpl2 UTSW 2 24094703 missense probably benign 0.35
R6936:Tbpl2 UTSW 2 24094941 missense probably benign 0.00
R7378:Tbpl2 UTSW 2 24094700 missense probably benign 0.14
R7382:Tbpl2 UTSW 2 24087314 intron probably null
Predicted Primers PCR Primer
(F):5'- ACAAGTTAAGCTGCATGTGTG -3'
(R):5'- AGGTGAGATTTAACATGTGGGATC -3'

Sequencing Primer
(F):5'- CAAGTTAAGCTGCATGTGTGATGATG -3'
(R):5'- GGGATCTTGAATGTTCTGGAAAACC -3'
Posted On2015-04-02