Incidental Mutation 'R3819:Dab2ip'
ID274803
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Namedisabled 2 interacting protein
Synonyms2310011D08Rik, AIP1
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35558266-35730994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35713210 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 417 (C417R)
Ref Sequence ENSEMBL: ENSMUSP00000122341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
Predicted Effect probably damaging
Transcript: ENSMUST00000065001
AA Change: C409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883
AA Change: C409R

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091010
AA Change: C474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883
AA Change: C474R

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112983
AA Change: C350R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883
AA Change: C350R

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112986
AA Change: C446R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883
AA Change: C446R

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112987
AA Change: C417R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883
AA Change: C417R

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112992
AA Change: C474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883
AA Change: C474R

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124098
AA Change: C367R
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883
AA Change: C367R

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135741
AA Change: C417R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: C417R

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138957
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156465
Predicted Effect unknown
Transcript: ENSMUST00000156669
AA Change: C99R
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883
AA Change: C99R

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35720013 missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35707775 missense probably benign 0.25
IGL00902:Dab2ip APN 2 35717112 missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35708877 missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35643897 missense probably benign 0.27
R0097:Dab2ip UTSW 2 35718916 missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35692376 critical splice donor site probably null
R0184:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1388:Dab2ip UTSW 2 35721256 intron probably benign
R1442:Dab2ip UTSW 2 35710256 missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35720278 missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35718815 missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35643891 nonsense probably null
R4333:Dab2ip UTSW 2 35661620 makesense probably null
R4869:Dab2ip UTSW 2 35720037 missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35730527 utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35709941 missense probably benign 0.03
R5180:Dab2ip UTSW 2 35720491 missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35709991 missense probably benign 0.25
R5513:Dab2ip UTSW 2 35710254 missense probably benign 0.11
R5579:Dab2ip UTSW 2 35715327 nonsense probably null
R5829:Dab2ip UTSW 2 35707775 unclassified probably benign
R5840:Dab2ip UTSW 2 35727499 missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35715402 missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35692255 nonsense probably null
R6235:Dab2ip UTSW 2 35723087 missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35710266 missense probably benign 0.38
R6571:Dab2ip UTSW 2 35712890 missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35730473 nonsense probably null
R7262:Dab2ip UTSW 2 35622286 splice site probably null
R7883:Dab2ip UTSW 2 35720206 missense possibly damaging 0.51
R7966:Dab2ip UTSW 2 35720206 missense possibly damaging 0.51
X0011:Dab2ip UTSW 2 35723085 nonsense probably null
Z1176:Dab2ip UTSW 2 35708868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTTGTGGGCCAGAAGTAC -3'
(R):5'- GTGGAATCAGATGCTGGCAC -3'

Sequencing Primer
(F):5'- CCAGAAGTACCTGCAGGACG -3'
(R):5'- ACCCAGGGCAGGAGTGG -3'
Posted On2015-04-02