Incidental Mutation 'R3819:Gbp7'
ID274807
Institutional Source Beutler Lab
Gene Symbol Gbp7
Ensembl Gene ENSMUSG00000040253
Gene Nameguanylate binding protein 7
Synonyms9830147J24Rik
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142530342-142550149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142544065 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 432 (H432Q)
Ref Sequence ENSEMBL: ENSMUSP00000132970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045097] [ENSMUST00000171263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045097
AA Change: H432Q

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049104
Gene: ENSMUSG00000040253
AA Change: H432Q

DomainStartEndE-ValueType
Pfam:GBP 18 281 6.6e-128 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171263
AA Change: H432Q

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132970
Gene: ENSMUSG00000040253
AA Change: H432Q

DomainStartEndE-ValueType
Pfam:GBP 18 281 1e-126 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197826
Meta Mutation Damage Score 0.7496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Gbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gbp7 APN 3 142546428 missense probably benign 0.01
IGL01020:Gbp7 APN 3 142542857 missense probably benign 0.03
IGL01959:Gbp7 APN 3 142541347 splice site probably benign
IGL02002:Gbp7 APN 3 142538900 missense probably damaging 1.00
IGL02008:Gbp7 APN 3 142546450 missense probably benign 0.11
PIT4366001:Gbp7 UTSW 3 142542951 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0398:Gbp7 UTSW 3 142545513 missense possibly damaging 0.93
R0486:Gbp7 UTSW 3 142546317 splice site probably benign
R0645:Gbp7 UTSW 3 142538165 intron probably null
R0961:Gbp7 UTSW 3 142541557 nonsense probably null
R1834:Gbp7 UTSW 3 142534680 missense probably damaging 1.00
R2089:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2089:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2091:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2181:Gbp7 UTSW 3 142544030 missense possibly damaging 0.87
R2921:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R2922:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R4747:Gbp7 UTSW 3 142543017 missense probably damaging 1.00
R4748:Gbp7 UTSW 3 142538087 missense probably benign 0.00
R5899:Gbp7 UTSW 3 142546542 missense probably benign
R6082:Gbp7 UTSW 3 142545936 missense probably benign 0.01
R6211:Gbp7 UTSW 3 142545993 missense probably benign 0.12
R6330:Gbp7 UTSW 3 142546498 missense probably benign
R6419:Gbp7 UTSW 3 142546453 missense probably benign 0.00
R7120:Gbp7 UTSW 3 142543973 missense probably damaging 1.00
R7338:Gbp7 UTSW 3 142538025 missense probably damaging 1.00
R7844:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7910:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
R7927:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7991:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTCAAGACCACAGTTG -3'
(R):5'- ATTCTGGATCTAGAGAAGCTGGAAG -3'

Sequencing Primer
(F):5'- ACAGCTTCCTTCTCTGATATCTCAAC -3'
(R):5'- TCTAGAGAAGCTGGAAGTGCATAG -3'
Posted On2015-04-02