Mutagenetix > Incidental Mutation

Incidental Mutation 'R3819:Rasef'

274808

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

040773-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R3819 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 73759705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Histidine at position 95 (D95H)

Ref Sequence

ENSEMBL: ENSMUSP00000099901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably damaging
Transcript: ENSMUST00000058292
AA Change: D167H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: D167H

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102837
AA Change: D95H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: D95H

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222414
AA Change: D248H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.1297

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	C	6: 86,959,042		probably benign	Het
Atp1b1	C	T	1: 164,443,305	R35H	probably benign	Het
Barx1	T	C	13: 48,665,484	I200T	possibly damaging	Het
Coil	T	C	11: 88,981,793	F380L	probably benign	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Dab2ip	T	C	2: 35,713,210	C417R	probably damaging	Het
Dhx57	A	G	17: 80,265,074		probably null	Het
Gabrg3	G	A	7: 57,381,664	Q43*	probably null	Het
Gbp7	C	A	3: 142,544,065	H432Q	possibly damaging	Het
Gjb2	A	G	14: 57,100,073	V226A	probably benign	Het
Gm13088	T	A	4: 143,655,795	E110D	probably benign	Het
Gsdme	A	C	6: 50,219,411	S340A	probably benign	Het
Hivep2	T	C	10: 14,143,941	V2152A	possibly damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Krt34	T	C	11: 100,040,018	E186G	probably damaging	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Msantd4	A	G	9: 4,385,237	K321E	probably damaging	Het
Olfr204	A	G	16: 59,315,071	F112S	probably damaging	Het
Olfr483	A	G	7: 108,103,498	Y63C	possibly damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Paxbp1	A	C	16: 91,022,752		probably benign	Het
Plcl1	T	A	1: 55,696,599	D366E	probably benign	Het
Prdm5	T	C	6: 65,936,057	F391L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Skint3	A	T	4: 112,255,888	I232F	possibly damaging	Het
Slc43a3	T	C	2: 84,944,552	I158T	probably damaging	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Sspo	A	T	6: 48,481,103	E3269V	possibly damaging	Het
Stat3	C	T	11: 100,898,633	S377N	probably damaging	Het
Tbpl2	A	G	2: 24,076,012	V321A	probably damaging	Het
Tnfrsf11a	C	T	1: 105,809,360	T64I	probably damaging	Het
Ttn	T	C	2: 76,898,703		probably benign	Het
Wdr37	A	G	13: 8,853,596		probably benign	Het
Xdh	A	T	17: 73,906,725	I811K	probably benign	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- ATGCCACAAGTATAGGCATGC -3'
(R):5'- GGTTTTCAAATCAGCTTTCCCAGAG -3'

Sequencing Primer
(F):5'- AAGCAGTGTTCCTCATAGGC -3'
(R):5'- ATCAGCTTTCCCAGAGTTTTAAAG -3'

Posted On

2015-04-02