Incidental Mutation 'R3819:Smad1'
ID274819
Institutional Source Beutler Lab
Gene Symbol Smad1
Ensembl Gene ENSMUSG00000031681
Gene NameSMAD family member 1
SynonymsMadh1, Smad 1, Madr1
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79338395-79399518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79343730 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 393 (A393V)
Ref Sequence ENSEMBL: ENSMUSP00000105511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]
Predicted Effect probably benign
Transcript: ENSMUST00000066091
AA Change: A393V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681
AA Change: A393V

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 441 2.73e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109885
AA Change: A393V

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681
AA Change: A393V

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 425 3.92e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210678
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Smad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad1 APN 8 79356469 missense probably damaging 0.97
IGL01792:Smad1 APN 8 79372123 missense probably damaging 1.00
R0395:Smad1 UTSW 8 79349782 missense probably benign 0.01
R0400:Smad1 UTSW 8 79371770 splice site probably benign
R0990:Smad1 UTSW 8 79343788 missense probably damaging 1.00
R1371:Smad1 UTSW 8 79349578 splice site probably benign
R1481:Smad1 UTSW 8 79343730 missense probably benign 0.20
R1661:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1665:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1797:Smad1 UTSW 8 79343844 missense probably damaging 1.00
R2879:Smad1 UTSW 8 79353455 splice site probably null
R3624:Smad1 UTSW 8 79339698 missense probably benign 0.31
R3791:Smad1 UTSW 8 79339770 missense probably damaging 1.00
R3815:Smad1 UTSW 8 79343730 missense probably benign 0.20
R4887:Smad1 UTSW 8 79349752 missense probably damaging 1.00
R5438:Smad1 UTSW 8 79356320 missense probably benign 0.19
X0064:Smad1 UTSW 8 79353404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGATTTACATGTTGTGAGAAGGC -3'
(R):5'- TAATAACTGACTGCCATGGCTG -3'

Sequencing Primer
(F):5'- ACATGTTGTGAGAAGGCATGTG -3'
(R):5'- GCAGGAGTCCACCTTTATTACG -3'
Posted On2015-04-02