Incidental Mutation 'R3819:Olfr922'
ID274823
Institutional Source Beutler Lab
Gene Symbol Olfr922
Ensembl Gene ENSMUSG00000043911
Gene Nameolfactory receptor 922
SynonymsGA_x6K02T2PVTD-32518237-32519172, MOR161-3
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38814614-38819195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38816426 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 308 (K308E)
Ref Sequence ENSEMBL: ENSMUSP00000149057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051004] [ENSMUST00000213164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051004
AA Change: K308E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057086
Gene: ENSMUSG00000043911
AA Change: K308E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.3e-52 PFAM
Pfam:7tm_1 41 290 3.4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213164
AA Change: K308E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Olfr922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr922 APN 9 38816039 missense probably damaging 0.99
IGL02445:Olfr922 APN 9 38815605 missense possibly damaging 0.57
R1758:Olfr922 UTSW 9 38815575 missense probably benign
R1759:Olfr922 UTSW 9 38815898 missense probably damaging 1.00
R1809:Olfr922 UTSW 9 38816147 missense probably benign
R1938:Olfr922 UTSW 9 38815850 missense probably benign 0.33
R2177:Olfr922 UTSW 9 38816186 missense possibly damaging 0.82
R3438:Olfr922 UTSW 9 38816216 missense probably damaging 0.99
R3815:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3816:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3817:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3859:Olfr922 UTSW 9 38816147 missense probably benign
R4768:Olfr922 UTSW 9 38815949 missense probably damaging 1.00
R5082:Olfr922 UTSW 9 38816145 missense possibly damaging 0.70
R5659:Olfr922 UTSW 9 38815776 missense probably benign 0.01
R5813:Olfr922 UTSW 9 38815656 missense probably benign 0.00
R6226:Olfr922 UTSW 9 38816370 missense probably damaging 0.99
R7240:Olfr922 UTSW 9 38815713 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGCAGATCTAAGGCTTTCAGC -3'
(R):5'- ACTTACGTTTTCTAATACCCTGTCAGG -3'

Sequencing Primer
(F):5'- CAGCACCTGTAGCTCACATATTATTG -3'
(R):5'- TTTCAGACCAGGTCAGCT -3'
Posted On2015-04-02