Incidental Mutation 'R3819:Krt34'
ID274829
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Namekeratin 34
SynonymsKrt1-4, 4733401E01Rik
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100037347-100041554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100040018 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
Predicted Effect probably damaging
Transcript: ENSMUST00000056362
AA Change: E186G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: E186G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Meta Mutation Damage Score 0.6737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr204 A G 16: 59,315,071 F112S probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 100038694 splice site probably benign
IGL01323:Krt34 APN 11 100038780 missense possibly damaging 0.95
IGL01403:Krt34 APN 11 100038290 missense possibly damaging 0.88
IGL01453:Krt34 APN 11 100040090 missense probably damaging 1.00
IGL02031:Krt34 APN 11 100039023 missense possibly damaging 0.95
IGL02831:Krt34 APN 11 100040147 splice site probably benign
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0220:Krt34 UTSW 11 100038693 splice site probably benign
R0242:Krt34 UTSW 11 100041331 missense probably damaging 1.00
R1573:Krt34 UTSW 11 100041028 missense probably benign 0.01
R1714:Krt34 UTSW 11 100040127 missense possibly damaging 0.95
R1879:Krt34 UTSW 11 100038292 missense possibly damaging 0.76
R3084:Krt34 UTSW 11 100041021 missense probably damaging 1.00
R3692:Krt34 UTSW 11 100039031 missense probably damaging 1.00
R3872:Krt34 UTSW 11 100041417 missense probably benign
R3876:Krt34 UTSW 11 100040965 missense probably benign 0.02
R6164:Krt34 UTSW 11 100038446 nonsense probably null
R6338:Krt34 UTSW 11 100038490 missense probably benign 0.00
R6457:Krt34 UTSW 11 100040090 missense probably damaging 1.00
R7728:Krt34 UTSW 11 100039985 critical splice donor site probably null
R7748:Krt34 UTSW 11 100038938 missense probably damaging 1.00
R7903:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
R7986:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
Z1176:Krt34 UTSW 11 100041434 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAGTGGTAAGGTCCTCCTG -3'
(R):5'- GTGGATACGCTCATGGAGTTC -3'

Sequencing Primer
(F):5'- CTCCTGGGTCCTTAGCTTAGAG -3'
(R):5'- ATGGAGTTCTTGGTCCAATACC -3'
Posted On2015-04-02