Incidental Mutation 'R3819:Or5ac22'
ID 274836
Institutional Source Beutler Lab
Gene Symbol Or5ac22
Ensembl Gene ENSMUSG00000095928
Gene Name olfactory receptor family 5 subfamily AC member 22
Synonyms Olfr204, MOR182-3, GA_x54KRFPKG5P-55529713-55528796
MMRRC Submission 040773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R3819 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 59134851-59135768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59135434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 112 (F112S)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
AlphaFold E9Q8M0
Predicted Effect probably damaging
Transcript: ENSMUST00000072517
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: F112S

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: F112S
Predicted Effect probably damaging
Transcript: ENSMUST00000216261
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3742 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,936,024 (GRCm39) probably benign Het
Atp1b1 C T 1: 164,270,874 (GRCm39) R35H probably benign Het
Barx1 T C 13: 48,818,960 (GRCm39) I200T possibly damaging Het
Coil T C 11: 88,872,619 (GRCm39) F380L probably benign Het
Csmd1 C T 8: 16,052,522 (GRCm39) A2201T probably damaging Het
Dab2ip T C 2: 35,603,222 (GRCm39) C417R probably damaging Het
Dhx57 A G 17: 80,572,503 (GRCm39) probably null Het
Gabrg3 G A 7: 57,031,412 (GRCm39) Q43* probably null Het
Gbp7 C A 3: 142,249,826 (GRCm39) H432Q possibly damaging Het
Gjb2 A G 14: 57,337,530 (GRCm39) V226A probably benign Het
Gsdme A C 6: 50,196,391 (GRCm39) S340A probably benign Het
Hivep2 T C 10: 14,019,685 (GRCm39) V2152A possibly damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Krt34 T C 11: 99,930,844 (GRCm39) E186G probably damaging Het
Ly9 G T 1: 171,416,653 (GRCm39) T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 (GRCm39) K321E probably damaging Het
Or5p59 A G 7: 107,702,705 (GRCm39) Y63C possibly damaging Het
Or8b12c C T 9: 37,715,465 (GRCm39) S86L probably benign Het
Or8b40 A T 9: 38,027,922 (GRCm39) T277S possibly damaging Het
Or8b55 A G 9: 38,727,722 (GRCm39) K308E possibly damaging Het
Paxbp1 A C 16: 90,819,640 (GRCm39) probably benign Het
Plcl1 T A 1: 55,735,758 (GRCm39) D366E probably benign Het
Pramel22 T A 4: 143,382,365 (GRCm39) E110D probably benign Het
Prdm5 T C 6: 65,913,041 (GRCm39) F391L possibly damaging Het
Rasef C G 4: 73,677,942 (GRCm39) D95H probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Skint3 A T 4: 112,113,085 (GRCm39) I232F possibly damaging Het
Slc43a3 T C 2: 84,774,896 (GRCm39) I158T probably damaging Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Sorl1 A G 9: 41,975,345 (GRCm39) L487P possibly damaging Het
Sspo A T 6: 48,458,037 (GRCm39) E3269V possibly damaging Het
Stat3 C T 11: 100,789,459 (GRCm39) S377N probably damaging Het
Tbpl2 A G 2: 23,966,024 (GRCm39) V321A probably damaging Het
Tnfrsf11a C T 1: 105,737,085 (GRCm39) T64I probably damaging Het
Ttn T C 2: 76,729,047 (GRCm39) probably benign Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Xdh A T 17: 74,213,720 (GRCm39) I811K probably benign Het
Other mutations in Or5ac22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Or5ac22 APN 16 59,134,891 (GRCm39) missense probably damaging 1.00
IGL01915:Or5ac22 APN 16 59,135,473 (GRCm39) missense probably damaging 1.00
R0265:Or5ac22 UTSW 16 59,135,434 (GRCm39) missense probably damaging 1.00
R0532:Or5ac22 UTSW 16 59,134,964 (GRCm39) missense probably benign 0.00
R1719:Or5ac22 UTSW 16 59,135,069 (GRCm39) nonsense probably null
R1864:Or5ac22 UTSW 16 59,135,378 (GRCm39) missense probably damaging 1.00
R1889:Or5ac22 UTSW 16 59,135,326 (GRCm39) missense probably damaging 0.98
R1925:Or5ac22 UTSW 16 59,135,027 (GRCm39) missense probably damaging 1.00
R2973:Or5ac22 UTSW 16 59,135,767 (GRCm39) start codon destroyed probably null 1.00
R3078:Or5ac22 UTSW 16 59,135,089 (GRCm39) missense probably benign
R4036:Or5ac22 UTSW 16 59,135,113 (GRCm39) missense probably benign
R4698:Or5ac22 UTSW 16 59,135,720 (GRCm39) missense probably damaging 1.00
R4930:Or5ac22 UTSW 16 59,135,236 (GRCm39) missense probably damaging 1.00
R5457:Or5ac22 UTSW 16 59,135,213 (GRCm39) missense probably benign 0.12
R6597:Or5ac22 UTSW 16 59,135,713 (GRCm39) missense probably benign 0.00
R7341:Or5ac22 UTSW 16 59,135,512 (GRCm39) missense possibly damaging 0.69
R7512:Or5ac22 UTSW 16 59,135,390 (GRCm39) missense probably damaging 0.99
R7702:Or5ac22 UTSW 16 59,134,997 (GRCm39) missense probably damaging 1.00
R8132:Or5ac22 UTSW 16 59,134,907 (GRCm39) missense possibly damaging 0.55
R9642:Or5ac22 UTSW 16 59,135,610 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CGCATAGAGTGGCATGATTTC -3'
(R):5'- TGGAAGGACCCTCATCTTCAC -3'

Sequencing Primer
(F):5'- CATAGAGTGGCATGATTTCACAGTAG -3'
(R):5'- TCATCTTCACACACCCATGTAC -3'
Posted On 2015-04-02