Incidental Mutation 'R3819:Olfr204'
ID274836
Institutional Source Beutler Lab
Gene Symbol Olfr204
Ensembl Gene ENSMUSG00000095928
Gene Nameolfactory receptor 204
SynonymsGA_x54KRFPKG5P-55529713-55528796, MOR182-3
MMRRC Submission 040773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3819 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59310206-59318248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59315071 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 112 (F112S)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
Predicted Effect probably damaging
Transcript: ENSMUST00000072517
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: F112S

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: F112S
Predicted Effect probably damaging
Transcript: ENSMUST00000216261
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3742 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,959,042 probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Barx1 T C 13: 48,665,484 I200T possibly damaging Het
Coil T C 11: 88,981,793 F380L probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Dab2ip T C 2: 35,713,210 C417R probably damaging Het
Dhx57 A G 17: 80,265,074 probably null Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gbp7 C A 3: 142,544,065 H432Q possibly damaging Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Gm13088 T A 4: 143,655,795 E110D probably benign Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
Hivep2 T C 10: 14,143,941 V2152A possibly damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt34 T C 11: 100,040,018 E186G probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 K321E probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Paxbp1 A C 16: 91,022,752 probably benign Het
Plcl1 T A 1: 55,696,599 D366E probably benign Het
Prdm5 T C 6: 65,936,057 F391L possibly damaging Het
Rasef C G 4: 73,759,705 D95H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint3 A T 4: 112,255,888 I232F possibly damaging Het
Slc43a3 T C 2: 84,944,552 I158T probably damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Stat3 C T 11: 100,898,633 S377N probably damaging Het
Tbpl2 A G 2: 24,076,012 V321A probably damaging Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Ttn T C 2: 76,898,703 probably benign Het
Wdr37 A G 13: 8,853,596 probably benign Het
Xdh A T 17: 73,906,725 I811K probably benign Het
Other mutations in Olfr204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr204 APN 16 59314528 missense probably damaging 1.00
IGL01915:Olfr204 APN 16 59315110 missense probably damaging 1.00
R0265:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R0532:Olfr204 UTSW 16 59314601 missense probably benign 0.00
R1719:Olfr204 UTSW 16 59314706 nonsense probably null
R1864:Olfr204 UTSW 16 59315015 missense probably damaging 1.00
R1889:Olfr204 UTSW 16 59314963 missense probably damaging 0.98
R1925:Olfr204 UTSW 16 59314664 missense probably damaging 1.00
R2973:Olfr204 UTSW 16 59315404 start codon destroyed probably null 1.00
R3078:Olfr204 UTSW 16 59314726 missense probably benign
R4036:Olfr204 UTSW 16 59314750 missense probably benign
R4698:Olfr204 UTSW 16 59315357 missense probably damaging 1.00
R4930:Olfr204 UTSW 16 59314873 missense probably damaging 1.00
R5457:Olfr204 UTSW 16 59314850 missense probably benign 0.12
R6597:Olfr204 UTSW 16 59315350 missense probably benign 0.00
R7341:Olfr204 UTSW 16 59315149 missense possibly damaging 0.69
R7512:Olfr204 UTSW 16 59315027 missense probably damaging 0.99
R7702:Olfr204 UTSW 16 59314634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATAGAGTGGCATGATTTC -3'
(R):5'- TGGAAGGACCCTCATCTTCAC -3'

Sequencing Primer
(F):5'- CATAGAGTGGCATGATTTCACAGTAG -3'
(R):5'- TCATCTTCACACACCCATGTAC -3'
Posted On2015-04-02