Incidental Mutation 'R3819:Dhx57'
ID 274839
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 040773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R3819 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 80572503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000038166] [ENSMUST00000086555] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably null
Transcript: ENSMUST00000038166
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038166
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086555
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,936,024 (GRCm39) probably benign Het
Atp1b1 C T 1: 164,270,874 (GRCm39) R35H probably benign Het
Barx1 T C 13: 48,818,960 (GRCm39) I200T possibly damaging Het
Coil T C 11: 88,872,619 (GRCm39) F380L probably benign Het
Csmd1 C T 8: 16,052,522 (GRCm39) A2201T probably damaging Het
Dab2ip T C 2: 35,603,222 (GRCm39) C417R probably damaging Het
Gabrg3 G A 7: 57,031,412 (GRCm39) Q43* probably null Het
Gbp7 C A 3: 142,249,826 (GRCm39) H432Q possibly damaging Het
Gjb2 A G 14: 57,337,530 (GRCm39) V226A probably benign Het
Gsdme A C 6: 50,196,391 (GRCm39) S340A probably benign Het
Hivep2 T C 10: 14,019,685 (GRCm39) V2152A possibly damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Krt34 T C 11: 99,930,844 (GRCm39) E186G probably damaging Het
Ly9 G T 1: 171,416,653 (GRCm39) T537N possibly damaging Het
Msantd4 A G 9: 4,385,237 (GRCm39) K321E probably damaging Het
Or5ac22 A G 16: 59,135,434 (GRCm39) F112S probably damaging Het
Or5p59 A G 7: 107,702,705 (GRCm39) Y63C possibly damaging Het
Or8b12c C T 9: 37,715,465 (GRCm39) S86L probably benign Het
Or8b40 A T 9: 38,027,922 (GRCm39) T277S possibly damaging Het
Or8b55 A G 9: 38,727,722 (GRCm39) K308E possibly damaging Het
Paxbp1 A C 16: 90,819,640 (GRCm39) probably benign Het
Plcl1 T A 1: 55,735,758 (GRCm39) D366E probably benign Het
Pramel22 T A 4: 143,382,365 (GRCm39) E110D probably benign Het
Prdm5 T C 6: 65,913,041 (GRCm39) F391L possibly damaging Het
Rasef C G 4: 73,677,942 (GRCm39) D95H probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Skint3 A T 4: 112,113,085 (GRCm39) I232F possibly damaging Het
Slc43a3 T C 2: 84,774,896 (GRCm39) I158T probably damaging Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Sorl1 A G 9: 41,975,345 (GRCm39) L487P possibly damaging Het
Sspo A T 6: 48,458,037 (GRCm39) E3269V possibly damaging Het
Stat3 C T 11: 100,789,459 (GRCm39) S377N probably damaging Het
Tbpl2 A G 2: 23,966,024 (GRCm39) V321A probably damaging Het
Tnfrsf11a C T 1: 105,737,085 (GRCm39) T64I probably damaging Het
Ttn T C 2: 76,729,047 (GRCm39) probably benign Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Xdh A T 17: 74,213,720 (GRCm39) I811K probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTAAGAAGTGAGACGTTAAGGTC -3'
(R):5'- TCCTATGTGGCACATGTCTG -3'

Sequencing Primer
(F):5'- CTTAACATCTGGCAAGGGGATAC -3'
(R):5'- GTGGCACATGTCTGACCCTTAAC -3'
Posted On 2015-04-02