Incidental Mutation 'R3820:Vmn2r16'
ID274852
Institutional Source Beutler Lab
Gene Symbol Vmn2r16
Ensembl Gene ENSMUSG00000092080
Gene Namevomeronasal 2, receptor 16
SynonymsEG384220
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109330381-109364481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109362277 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 509 (P509S)
Ref Sequence ENSEMBL: ENSMUSP00000127838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165180]
Predicted Effect probably benign
Transcript: ENSMUST00000165180
AA Change: P509S

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: P509S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.3e-28 PFAM
Pfam:NCD3G 509 563 8.2e-19 PFAM
Pfam:7tm_3 596 831 3.5e-56 PFAM
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Vmn2r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Vmn2r16 APN 5 109340428 missense probably damaging 1.00
IGL01374:Vmn2r16 APN 5 109330417 missense probably benign 0.00
IGL01391:Vmn2r16 APN 5 109363761 missense possibly damaging 0.50
IGL01419:Vmn2r16 APN 5 109362401 splice site probably benign
IGL01634:Vmn2r16 APN 5 109340311 missense probably benign 0.00
IGL01845:Vmn2r16 APN 5 109363896 missense probably damaging 1.00
IGL01875:Vmn2r16 APN 5 109330411 missense probably benign 0.01
IGL01910:Vmn2r16 APN 5 109340085 missense probably damaging 1.00
IGL02217:Vmn2r16 APN 5 109339810 missense probably damaging 0.98
IGL02327:Vmn2r16 APN 5 109340121 missense probably benign 0.01
IGL02491:Vmn2r16 APN 5 109339837 nonsense probably null
IGL02531:Vmn2r16 APN 5 109340268 missense probably damaging 0.99
IGL02680:Vmn2r16 APN 5 109340082 missense probably benign 0.44
IGL02884:Vmn2r16 APN 5 109360891 missense possibly damaging 0.94
IGL03084:Vmn2r16 APN 5 109330426 missense probably damaging 0.99
IGL03096:Vmn2r16 APN 5 109339885 missense probably damaging 0.99
IGL03355:Vmn2r16 APN 5 109363714 missense possibly damaging 0.74
R0280:Vmn2r16 UTSW 5 109340139 missense possibly damaging 0.88
R0594:Vmn2r16 UTSW 5 109363896 missense probably damaging 1.00
R1016:Vmn2r16 UTSW 5 109339888 missense probably damaging 1.00
R1109:Vmn2r16 UTSW 5 109339786 missense probably damaging 0.98
R1248:Vmn2r16 UTSW 5 109360777 missense probably benign 0.10
R1626:Vmn2r16 UTSW 5 109363577 missense probably damaging 1.00
R1909:Vmn2r16 UTSW 5 109363987 missense probably benign 0.01
R1929:Vmn2r16 UTSW 5 109339258 missense possibly damaging 0.92
R1982:Vmn2r16 UTSW 5 109364024 missense probably benign 0.01
R3038:Vmn2r16 UTSW 5 109339333 missense probably damaging 1.00
R3437:Vmn2r16 UTSW 5 109330496 missense probably damaging 0.99
R3734:Vmn2r16 UTSW 5 109330414 missense probably benign 0.11
R3873:Vmn2r16 UTSW 5 109340311 missense probably benign 0.33
R4165:Vmn2r16 UTSW 5 109330561 missense possibly damaging 0.80
R4373:Vmn2r16 UTSW 5 109363801 missense probably damaging 1.00
R4575:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4576:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4578:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4637:Vmn2r16 UTSW 5 109330414 missense probably benign 0.00
R4696:Vmn2r16 UTSW 5 109339302 missense probably benign 0.01
R5026:Vmn2r16 UTSW 5 109360856 nonsense probably null
R5180:Vmn2r16 UTSW 5 109330525 missense probably benign 0.01
R5433:Vmn2r16 UTSW 5 109363842 missense probably damaging 1.00
R5955:Vmn2r16 UTSW 5 109363747 missense possibly damaging 0.78
R5958:Vmn2r16 UTSW 5 109362287 missense possibly damaging 0.81
R6353:Vmn2r16 UTSW 5 109340253 missense probably benign 0.33
R6389:Vmn2r16 UTSW 5 109330478 missense probably benign 0.19
R6819:Vmn2r16 UTSW 5 109340546 missense probably benign 0.04
R6994:Vmn2r16 UTSW 5 109340103 missense probably damaging 1.00
R7061:Vmn2r16 UTSW 5 109363754 missense probably damaging 0.99
R7063:Vmn2r16 UTSW 5 109363784 missense probably damaging 1.00
R7220:Vmn2r16 UTSW 5 109360906 missense probably damaging 0.97
R7268:Vmn2r16 UTSW 5 109340465 nonsense probably null
R7420:Vmn2r16 UTSW 5 109363870 missense probably damaging 0.96
X0027:Vmn2r16 UTSW 5 109339309 missense probably damaging 1.00
Z1088:Vmn2r16 UTSW 5 109340515 missense probably benign 0.03
Z1088:Vmn2r16 UTSW 5 109363913 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGTGACTGTCAGGGCATTG -3'
(R):5'- AGGCCATTTCACAATTCTAGTTTGG -3'

Sequencing Primer
(F):5'- ACTGTCAGGGCATTGCAATC -3'
(R):5'- CTCATTTTCTGGGCACAG -3'
Posted On2015-04-02