Incidental Mutation 'R3820:Pds5b'
ID274855
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene NamePDS5 cohesin associated factor B
SynonymsAprin, AS3
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150673739-150810690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150736337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000144572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016569
AA Change: V255A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: V255A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038900
AA Change: V255A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: V255A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202170
AA Change: V255A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: V255A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0745:Pds5b UTSW 5 150805671 missense probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3911:Pds5b UTSW 5 150746706 missense probably benign 0.41
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6225:Pds5b UTSW 5 150746618 missense probably damaging 0.98
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGATGGAAAATGTTTCTGTGTTG -3'
(R):5'- AGGTATCTCTCCAAGCACGAG -3'

Sequencing Primer
(F):5'- AAATGTTTCTGTGTTGCTTGTTTGAC -3'
(R):5'- CCCAGAGATAGGCAGCAGC -3'
Posted On2015-04-02