Incidental Mutation 'R3820:Fam196b'
ID274863
Institutional Source Beutler Lab
Gene Symbol Fam196b
Ensembl Gene ENSMUSG00000069911
Gene Namefamily with sequence similarity 196, member B
SynonymsGm6041
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location34314822-34422640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34403007 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 350 (S350P)
Ref Sequence ENSEMBL: ENSMUSP00000129183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably benign
Transcript: ENSMUST00000093192
AA Change: S350P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: S350P

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165963
AA Change: S350P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: S350P

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Fam196b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Fam196b APN 11 34403011 missense probably benign
IGL01867:Fam196b APN 11 34403065 missense probably benign 0.39
PIT4677001:Fam196b UTSW 11 34403122 missense probably benign
R0317:Fam196b UTSW 11 34402826 missense possibly damaging 0.94
R1165:Fam196b UTSW 11 34402740 missense probably benign
R1710:Fam196b UTSW 11 34404263 splice site probably null
R2083:Fam196b UTSW 11 34402141 missense probably benign 0.01
R2096:Fam196b UTSW 11 34402936 missense probably benign 0.03
R3821:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3822:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3969:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3970:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3980:Fam196b UTSW 11 34402678 missense probably benign 0.00
R4092:Fam196b UTSW 11 34401935 start gained probably benign
R4231:Fam196b UTSW 11 34403143 missense probably benign 0.01
R4678:Fam196b UTSW 11 34403227 missense probably damaging 1.00
R4859:Fam196b UTSW 11 34403154 missense probably benign 0.31
R4938:Fam196b UTSW 11 34402231 missense probably damaging 0.98
R5269:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5287:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5358:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5359:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5361:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5362:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5363:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5403:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5705:Fam196b UTSW 11 34404349 missense probably damaging 1.00
R6282:Fam196b UTSW 11 34402819 missense possibly damaging 0.77
R7030:Fam196b UTSW 11 34402030 missense probably damaging 0.96
R7069:Fam196b UTSW 11 34402677 missense possibly damaging 0.48
R7178:Fam196b UTSW 11 34402359 missense probably damaging 0.96
R7180:Fam196b UTSW 11 34419873 missense probably damaging 1.00
R7718:Fam196b UTSW 11 34402539 missense probably benign 0.00
R7789:Fam196b UTSW 11 34402537 missense probably benign
R7832:Fam196b UTSW 11 34403034 missense probably benign
R7915:Fam196b UTSW 11 34403034 missense probably benign
Z1177:Fam196b UTSW 11 34402725 missense probably benign 0.01
Z1177:Fam196b UTSW 11 34403188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGACCTTGGCCTTCCATC -3'
(R):5'- ATTCCTCTACTGATTGCAGCCG -3'

Sequencing Primer
(F):5'- CCATCATCTCAGTCAAAGAAGATGTG -3'
(R):5'- AGGTCACAGAGCTCTCCCTG -3'
Posted On2015-04-02