Incidental Mutation 'R3820:Cnot6'
ID274865
Institutional Source Beutler Lab
Gene Symbol Cnot6
Ensembl Gene ENSMUSG00000020362
Gene NameCCR4-NOT transcription complex, subunit 6
SynonymsA230103N10Rik
MMRRC Submission 040882-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R3820 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49671503-49712723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49689172 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 98 (S98T)
Ref Sequence ENSEMBL: ENSMUSP00000121239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020624] [ENSMUST00000145353]
Predicted Effect probably benign
Transcript: ENSMUST00000020624
AA Change: S98T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020624
Gene: ENSMUSG00000020362
AA Change: S98T

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 187 526 1.9e-23 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109183
Predicted Effect probably benign
Transcript: ENSMUST00000145353
AA Change: S98T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121239
Gene: ENSMUSG00000020362
AA Change: S98T

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 192 531 1.9e-23 PFAM
low complexity region 534 547 N/A INTRINSIC
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G T 18: 6,630,166 probably null Het
4932438A13Rik G A 3: 37,040,434 V917I probably damaging Het
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Adam6a T C 12: 113,544,178 I57T probably benign Het
Adam6b C T 12: 113,490,364 T267I probably benign Het
Ap1g2 G A 14: 55,100,573 probably benign Het
Arhgap22 G A 14: 33,367,421 E455K probably benign Het
Ccdc93 T C 1: 121,462,240 I253T probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Dnah9 C A 11: 65,851,003 probably null Het
Edar T C 10: 58,621,363 Y131C probably damaging Het
Eif5 A T 12: 111,540,184 R43* probably null Het
Eml4 C A 17: 83,473,065 T667K probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flt1 A G 5: 147,700,017 probably benign Het
Frem2 T A 3: 53,516,849 I3056F probably damaging Het
Hivep1 A T 13: 42,184,311 H2622L possibly damaging Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Kcnma1 T C 14: 23,299,938 T1178A possibly damaging Het
Kcnt1 A G 2: 25,900,892 H486R probably damaging Het
Kif21a T C 15: 90,968,074 N950S probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lrrc4b T A 7: 44,462,558 V618E probably damaging Het
Micall2 C T 5: 139,715,856 G461D possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Pds5a A G 5: 65,654,076 V338A possibly damaging Het
Pds5b T C 5: 150,736,337 V255A possibly damaging Het
Prkar2a T G 9: 108,746,956 F391V probably damaging Het
Prr14l A G 5: 32,828,984 C1056R probably damaging Het
Ptpn23 A G 9: 110,389,794 probably benign Het
Serpinb5 T A 1: 106,875,072 Y112* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdrd5 A G 1: 156,285,483 V409A probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Trpm3 A T 19: 22,987,449 N1436I probably benign Het
Unc13c A T 9: 73,930,958 S870R probably benign Het
Vmn2r16 C T 5: 109,362,277 P509S probably benign Het
Vmn2r60 A T 7: 42,135,701 E112D probably damaging Het
Xpnpep1 G A 19: 53,003,819 probably benign Het
Zfp729a A T 13: 67,621,319 C264S probably damaging Het
Zmynd8 T A 2: 165,815,461 K521* probably null Het
Other mutations in Cnot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Cnot6 APN 11 49685266 missense probably benign 0.01
IGL00969:Cnot6 APN 11 49685120 missense probably benign
IGL01655:Cnot6 APN 11 49677304 missense probably damaging 1.00
IGL02074:Cnot6 APN 11 49689243 missense probably benign 0.00
IGL02670:Cnot6 APN 11 49685114 nonsense probably null
R0326:Cnot6 UTSW 11 49677436 missense probably damaging 1.00
R0625:Cnot6 UTSW 11 49683171 missense probably damaging 1.00
R1079:Cnot6 UTSW 11 49685103 missense probably benign 0.01
R3821:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3822:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R4202:Cnot6 UTSW 11 49702636 missense probably damaging 1.00
R4515:Cnot6 UTSW 11 49702536 splice site probably null
R6010:Cnot6 UTSW 11 49683239 nonsense probably null
R6193:Cnot6 UTSW 11 49680023 missense probably benign 0.06
R7149:Cnot6 UTSW 11 49680143 missense probably benign
R7501:Cnot6 UTSW 11 49685332 missense probably benign 0.01
R7556:Cnot6 UTSW 11 49675317 missense probably benign 0.15
R8263:Cnot6 UTSW 11 49682175 missense probably damaging 0.99
RF003:Cnot6 UTSW 11 49702613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTCTGGACAGTCAATTCTTACC -3'
(R):5'- TGGCAGCCGCTCTATCTAAC -3'

Sequencing Primer
(F):5'- AAAGCCATGCCTCCTTTC -3'
(R):5'- TTTGTCTTGCAGGAAAAGTAAGAAGC -3'
Posted On2015-04-02