Mutagenetix > Incidental Mutation

Incidental Mutation 'R3820:Xpnpep1'

274888

Institutional Source

Beutler Lab

Gene Symbol

Xpnpep1

Ensembl Gene

ENSMUSG00000025027

Gene Name

X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

Synonyms

D230045I08Rik

MMRRC Submission

040882-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3820 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52943417-53040214 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 53003819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]

AlphaFold

Q6P1B1

Predicted Effect

probably benign
Transcript: ENSMUST00000069988

SMART Domains

Protein: ENSMUSP00000070946
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	10	154	5.2e-15	PFAM
Pfam:Creatinase_N_2	157	326	1.4e-47	PFAM
Pfam:Peptidase_M24	328	544	7.2e-52	PFAM
Pfam:Peptidase_M24_C	555	619	7.3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182877

Predicted Effect

probably benign
Transcript: ENSMUST00000183108

SMART Domains

Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	53	198	1.2e-17	PFAM
Pfam:Peptidase_M24	371	587	5.5e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183188

Predicted Effect

probably benign
Transcript: ENSMUST00000183274

SMART Domains

Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	53	198	1.2e-17	PFAM
Pfam:Peptidase_M24	371	587	1.9e-48	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.8%
20x: 96.4%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	T	18: 6,630,166		probably null	Het
4932438A13Rik	G	A	3: 37,040,434	V917I	probably damaging	Het
Aarsd1	T	A	11: 101,411,145	I332F	probably damaging	Het
Abcd2	C	T	15: 91,174,705	G512D	probably damaging	Het
Adam6a	T	C	12: 113,544,178	I57T	probably benign	Het
Adam6b	C	T	12: 113,490,364	T267I	probably benign	Het
Ap1g2	G	A	14: 55,100,573		probably benign	Het
Arhgap22	G	A	14: 33,367,421	E455K	probably benign	Het
Ccdc93	T	C	1: 121,462,240	I253T	probably damaging	Het
Cd44	T	C	2: 102,901,393		probably null	Het
Cnot6	A	T	11: 49,689,172	S98T	probably benign	Het
Dnah9	C	A	11: 65,851,003		probably null	Het
Edar	T	C	10: 58,621,363	Y131C	probably damaging	Het
Eif5	A	T	12: 111,540,184	R43*	probably null	Het
Eml4	C	A	17: 83,473,065	T667K	probably damaging	Het
Fam196b	T	C	11: 34,403,007	S350P	probably benign	Het
Fchsd1	A	G	18: 37,969,457		probably benign	Het
Flt1	A	G	5: 147,700,017		probably benign	Het
Frem2	T	A	3: 53,516,849	I3056F	probably damaging	Het
Hivep1	A	T	13: 42,184,311	H2622L	possibly damaging	Het
Ido2	T	C	8: 24,533,755	I356V	probably benign	Het
Itgb3	C	A	11: 104,633,612	Y191*	probably null	Het
Kcnma1	T	C	14: 23,299,938	T1178A	possibly damaging	Het
Kcnt1	A	G	2: 25,900,892	H486R	probably damaging	Het
Kif21a	T	C	15: 90,968,074	N950S	probably benign	Het
Lama1	C	A	17: 67,779,046		probably null	Het
Lrrc4b	T	A	7: 44,462,558	V618E	probably damaging	Het
Micall2	C	T	5: 139,715,856	G461D	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Ncoa6	T	A	2: 155,406,938	N1482I	probably damaging	Het
Pcdhga10	A	G	18: 37,747,942	N252S	probably damaging	Het
Pcdhgb7	C	A	18: 37,752,233	T152K	possibly damaging	Het
Pds5a	A	G	5: 65,654,076	V338A	possibly damaging	Het
Pds5b	T	C	5: 150,736,337	V255A	possibly damaging	Het
Prkar2a	T	G	9: 108,746,956	F391V	probably damaging	Het
Prr14l	A	G	5: 32,828,984	C1056R	probably damaging	Het
Ptpn23	A	G	9: 110,389,794		probably benign	Het
Serpinb5	T	A	1: 106,875,072	Y112*	probably null	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Tdrd5	A	G	1: 156,285,483	V409A	probably benign	Het
Tenm2	A	T	11: 36,024,320	I2129N	probably damaging	Het
Tmem8b	C	A	4: 43,689,745	H800N	probably damaging	Het
Trpm3	A	T	19: 22,987,449	N1436I	probably benign	Het
Unc13c	A	T	9: 73,930,958	S870R	probably benign	Het
Vmn2r16	C	T	5: 109,362,277	P509S	probably benign	Het
Vmn2r60	A	T	7: 42,135,701	E112D	probably damaging	Het
Zfp729a	A	T	13: 67,621,319	C264S	probably damaging	Het
Zmynd8	T	A	2: 165,815,461	K521*	probably null	Het

Other mutations in Xpnpep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Xpnpep1	APN	19	53010148	missense	probably benign	0.06
IGL01665:Xpnpep1	APN	19	52997032	missense	probably benign	0.00
IGL01833:Xpnpep1	APN	19	53000393	missense	probably damaging	1.00
IGL02011:Xpnpep1	APN	19	53002465	critical splice donor site	probably benign	0.00
IGL03229:Xpnpep1	APN	19	53025380	missense	probably benign
IGL03334:Xpnpep1	APN	19	53010146	missense	probably damaging	1.00
R0226:Xpnpep1	UTSW	19	53010152	missense	probably benign	0.03
R0613:Xpnpep1	UTSW	19	53006353	missense	probably damaging	0.97
R0648:Xpnpep1	UTSW	19	52997863	splice site	probably benign
R1543:Xpnpep1	UTSW	19	52991676	missense	probably benign	0.24
R1553:Xpnpep1	UTSW	19	53006338	missense	probably benign	0.00
R1801:Xpnpep1	UTSW	19	53010133	missense	probably damaging	1.00
R1853:Xpnpep1	UTSW	19	53006210	missense	probably benign	0.01
R2234:Xpnpep1	UTSW	19	53013461	missense	probably damaging	1.00
R3797:Xpnpep1	UTSW	19	53006342	missense	probably benign	0.28
R3822:Xpnpep1	UTSW	19	53003819	splice site	probably benign
R3925:Xpnpep1	UTSW	19	52991697	missense	probably damaging	1.00
R4831:Xpnpep1	UTSW	19	53014622	missense	probably benign	0.09
R5033:Xpnpep1	UTSW	19	53006175	missense	probably benign
R5184:Xpnpep1	UTSW	19	53013414	missense	probably benign	0.24
R5468:Xpnpep1	UTSW	19	52995519	missense	probably benign	0.01
R5573:Xpnpep1	UTSW	19	53004822	missense	probably damaging	1.00
R5876:Xpnpep1	UTSW	19	52997008	missense	probably damaging	1.00
R5929:Xpnpep1	UTSW	19	53013489	missense	probably damaging	1.00
R6454:Xpnpep1	UTSW	19	52997879	missense	possibly damaging	0.91
R6519:Xpnpep1	UTSW	19	53011844	missense	possibly damaging	0.90
R7095:Xpnpep1	UTSW	19	53011765	critical splice donor site	probably null
R7112:Xpnpep1	UTSW	19	53010107	missense	probably benign
R7412:Xpnpep1	UTSW	19	53006291	missense	probably benign
R8329:Xpnpep1	UTSW	19	53002472	critical splice donor site	probably null
R8431:Xpnpep1	UTSW	19	52995506	missense	probably benign	0.04
R9194:Xpnpep1	UTSW	19	53011858	missense	possibly damaging	0.68
R9342:Xpnpep1	UTSW	19	53004817	missense	probably benign	0.02
R9388:Xpnpep1	UTSW	19	53004802	missense	probably damaging	1.00
R9546:Xpnpep1	UTSW	19	53002528	missense	probably damaging	1.00
R9746:Xpnpep1	UTSW	19	53013461	missense	probably damaging	1.00
RF017:Xpnpep1	UTSW	19	53032060	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GACTCTCTAACACGGATGCAC -3'
(R):5'- CCAGTAATGGGAAGTGCTACAG -3'

Sequencing Primer
(F):5'- TCTAACACGGATGCACAGACTTATAG -3'
(R):5'- TGCTACAGAAGGCTTCCAGG -3'

Posted On

2015-04-02