Incidental Mutation 'R3821:Tmem131'
ID274889
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Nametransmembrane protein 131
Synonyms2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36792191-36943666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36808396 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1207 (H1207L)
Ref Sequence ENSEMBL: ENSMUSP00000142307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000194563]
Predicted Effect probably damaging
Transcript: ENSMUST00000027290
AA Change: H1207L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116
AA Change: H1207L

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191381
Predicted Effect probably damaging
Transcript: ENSMUST00000194563
AA Change: H1207L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116
AA Change: H1207L

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2879:Tmem131 UTSW 1 36841707 missense possibly damaging 0.76
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3961:Tmem131 UTSW 1 36818950 missense probably damaging 1.00
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4154:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7916:Tmem131 UTSW 1 36823086 missense probably benign 0.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGCAGCTGTCTCTGAG -3'
(R):5'- AAACTGTAGAAGGTTGTGGCTC -3'

Sequencing Primer
(F):5'- GTCTCTGAGACTAGGGGGC -3'
(R):5'- AGAAGGTTGTGGCTCTGATCCC -3'
Posted On2015-04-02