Incidental Mutation 'R3821:Erbb4'
ID 274890
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 040883-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3821 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68345072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 550 (S550P)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: S550P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: S550P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: S550P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: S550P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126682
Predicted Effect possibly damaging
Transcript: ENSMUST00000153432
AA Change: S550P

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: S550P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.1996 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,301,971 (GRCm39) I332F probably damaging Het
Abcd2 C T 15: 91,058,908 (GRCm39) G512D probably damaging Het
Acp3 G T 9: 104,201,916 (GRCm39) Q76K probably damaging Het
Adamtsl3 G T 7: 82,255,687 (GRCm39) probably benign Het
Alox8 T A 11: 69,077,308 (GRCm39) I481F probably damaging Het
Anp32e A T 3: 95,842,181 (GRCm39) I100L probably benign Het
Arpin G A 7: 79,579,408 (GRCm39) R72C probably damaging Het
C6 A G 15: 4,819,066 (GRCm39) E466G probably benign Het
Ccdc13 C A 9: 121,660,085 (GRCm39) L76F probably damaging Het
Cd44 T C 2: 102,731,738 (GRCm39) probably null Het
Clgn A G 8: 84,147,106 (GRCm39) I353V probably null Het
Cnot6 A T 11: 49,579,999 (GRCm39) S98T probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cramp1 G A 17: 25,193,756 (GRCm39) T908I probably damaging Het
Dnah9 C A 11: 65,741,829 (GRCm39) probably null Het
Ehd3 A T 17: 74,134,390 (GRCm39) I250F probably benign Het
Eml2 T C 7: 18,936,911 (GRCm39) V555A possibly damaging Het
Fchsd1 A G 18: 38,102,510 (GRCm39) probably benign Het
Flad1 T A 3: 89,318,494 (GRCm39) I20F probably damaging Het
Frem2 A T 3: 53,559,836 (GRCm39) L1557Q probably damaging Het
Gbf1 T C 19: 46,253,246 (GRCm39) I506T probably damaging Het
Gm20730 C T 6: 43,058,656 (GRCm39) S52N probably benign Het
Hoxc9 A G 15: 102,890,596 (GRCm39) K171R probably benign Het
Hscb A T 5: 110,984,194 (GRCm39) D52E probably damaging Het
Htr1b A T 9: 81,514,487 (GRCm39) I40N probably benign Het
Ido2 T C 8: 25,023,771 (GRCm39) I356V probably benign Het
Insyn2b T C 11: 34,353,007 (GRCm39) S350P probably benign Het
Irs1 T C 1: 82,267,770 (GRCm39) T149A probably benign Het
Itgam A G 7: 127,711,458 (GRCm39) probably null Het
Itpr2 A T 6: 146,319,224 (GRCm39) H244Q probably damaging Het
Kcnma1 A G 14: 23,417,679 (GRCm39) I846T probably damaging Het
Kdm3a A T 6: 71,588,661 (GRCm39) D449E probably benign Het
Lama1 C A 17: 68,086,041 (GRCm39) probably null Het
Lhfpl4 A G 6: 113,171,069 (GRCm39) V39A probably benign Het
Marf1 A T 16: 13,960,418 (GRCm39) L542Q probably damaging Het
Mns1 A G 9: 72,346,730 (GRCm39) E71G probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrpl19 C A 6: 81,938,987 (GRCm39) E272* probably null Het
Ncoa6 T A 2: 155,248,858 (GRCm39) N1482I probably damaging Het
Neto2 C A 8: 86,389,924 (GRCm39) E180* probably null Het
Or2a51 A G 6: 43,178,604 (GRCm39) T9A probably benign Het
Pcdhga10 A G 18: 37,880,995 (GRCm39) N252S probably damaging Het
Pcdhgb7 C A 18: 37,885,286 (GRCm39) T152K possibly damaging Het
Ptprb G T 10: 116,185,979 (GRCm39) R1678L probably benign Het
Ptprg A T 14: 12,226,375 (GRCm38) I1323L probably benign Het
Rab40b T A 11: 121,248,874 (GRCm39) N127I probably damaging Het
Scn10a A G 9: 119,467,699 (GRCm39) C814R probably benign Het
Sdhb C T 4: 140,706,399 (GRCm39) R279* probably null Het
Shroom4 C T X: 6,536,276 (GRCm39) Q1165* probably null Het
Slc17a4 C T 13: 24,085,752 (GRCm39) R387H probably benign Het
Slc20a2 A G 8: 23,028,918 (GRCm39) I130V probably benign Het
Slitrk3 T C 3: 72,956,549 (GRCm39) Y741C possibly damaging Het
Tas1r1 G T 4: 152,119,138 (GRCm39) L144I probably benign Het
Tenm2 A T 11: 35,915,147 (GRCm39) I2129N probably damaging Het
Tmbim1 A G 1: 74,333,089 (GRCm39) V92A probably damaging Het
Tmem131 T A 1: 36,847,477 (GRCm39) H1207L probably damaging Het
Tmem209 G T 6: 30,505,959 (GRCm39) P116T probably damaging Het
Tmem8b C A 4: 43,689,745 (GRCm39) H800N probably damaging Het
Tnfsf8 A G 4: 63,779,127 (GRCm39) V57A probably benign Het
Topaz1 A G 9: 122,626,848 (GRCm39) D1492G possibly damaging Het
Trank1 G A 9: 111,207,887 (GRCm39) G1711R probably damaging Het
Trpc6 A T 9: 8,610,279 (GRCm39) D249V probably damaging Het
Ubr3 G A 2: 69,824,157 (GRCm39) probably null Het
Ufc1 A G 1: 171,117,172 (GRCm39) probably benign Het
Unc5cl T C 17: 48,767,001 (GRCm39) L125P possibly damaging Het
Usb1 G A 8: 96,060,061 (GRCm39) S57N probably benign Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Zfp618 G A 4: 63,051,801 (GRCm39) A861T probably benign Het
Zfp831 T C 2: 174,485,816 (GRCm39) S164P possibly damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCAACAGTGTATCTTGTCCCAAG -3'
(R):5'- AAAGTGCATCTGTGACTCCTG -3'

Sequencing Primer
(F):5'- GTCCCAAGAACTCTATACTTTTAGTC -3'
(R):5'- GTGACTCCTGGCACATTACAG -3'
Posted On 2015-04-02