Incidental Mutation 'R3821:Irs1'
ID274893
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82290049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 149 (T149A)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect probably benign
Transcript: ENSMUST00000069799
AA Change: T149A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: T149A

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7991:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7993:Irs1 UTSW 1 82289884 missense probably benign
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense possibly damaging 0.87
Z1177:Irs1 UTSW 1 82290394 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TATTCATCAGCTGCAGCACC -3'
(R):5'- AACATCAACAAGCGGGCTG -3'

Sequencing Primer
(F):5'- AGCTGCAGCACCACAGC -3'
(R):5'- CCGAGACGAACACTTTGCCATTG -3'
Posted On2015-04-02