Incidental Mutation 'R3821:Mrpl19'
ID274913
Institutional Source Beutler Lab
Gene Symbol Mrpl19
Ensembl Gene ENSMUSG00000030045
Gene Namemitochondrial ribosomal protein L19
SynonymsRpml15, D6Ertd157e, 9030416F12Rik, RLX1, MRP-L15
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location81957851-81965958 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81962006 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 272 (E272*)
Ref Sequence ENSEMBL: ENSMUSP00000032124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably null
Transcript: ENSMUST00000032124
AA Change: E272*
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045
AA Change: E272*

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043195
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148025
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203959
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Mrpl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL00563:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL02113:Mrpl19 APN 6 81965915 missense probably benign
IGL02116:Mrpl19 APN 6 81965777 missense probably benign 0.41
IGL02256:Mrpl19 APN 6 81964319 missense probably benign 0.06
IGL02347:Mrpl19 APN 6 81962011 missense probably damaging 0.99
IGL02415:Mrpl19 APN 6 81963961 missense probably benign 0.29
IGL02825:Mrpl19 APN 6 81965815 missense probably benign 0.25
IGL03189:Mrpl19 APN 6 81961993 nonsense probably null
R1824:Mrpl19 UTSW 6 81964079 splice site probably null
R2310:Mrpl19 UTSW 6 81964073 splice site probably null
R3176:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3276:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R4705:Mrpl19 UTSW 6 81964285 missense probably damaging 0.99
R4736:Mrpl19 UTSW 6 81964348 missense probably damaging 1.00
R5464:Mrpl19 UTSW 6 81962011 missense probably damaging 0.99
R7408:Mrpl19 UTSW 6 81965812 missense possibly damaging 0.65
R7835:Mrpl19 UTSW 6 81962126 missense probably damaging 1.00
Z1177:Mrpl19 UTSW 6 81964310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTCAGAACAAGGGCTTAAAAG -3'
(R):5'- TTTTGTGTGCACCTCACCAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- AGCCCACAATTCCTGTTTTTG -3'
Posted On2015-04-02