Incidental Mutation 'R3821:Topaz1'
ID274932
Institutional Source Beutler Lab
Gene Symbol Topaz1
Ensembl Gene ENSMUSG00000094985
Gene Nametestis and ovary specific PAZ domain containing 1
SynonymsGm9524
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122747346-122802135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122797783 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1492 (D1492G)
Ref Sequence ENSEMBL: ENSMUSP00000136304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178679
AA Change: D1492G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136304
Gene: ENSMUSG00000094985
AA Change: D1492G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
low complexity region 236 251 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
low complexity region 1129 1139 N/A INTRINSIC
Pfam:Asp_Glu_race_2 1189 1422 3.6e-157 PFAM
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with abnormal meiosis and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Topaz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0108:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0220:Topaz1 UTSW 9 122749303 missense possibly damaging 0.53
R0519:Topaz1 UTSW 9 122749479 missense possibly damaging 0.53
R0617:Topaz1 UTSW 9 122749906 missense possibly damaging 0.73
R0637:Topaz1 UTSW 9 122791477 nonsense probably null
R0637:Topaz1 UTSW 9 122797662 missense probably benign
R1368:Topaz1 UTSW 9 122748250 missense possibly damaging 0.72
R1519:Topaz1 UTSW 9 122767011 missense probably benign 0.33
R1526:Topaz1 UTSW 9 122796043 missense probably damaging 0.98
R1634:Topaz1 UTSW 9 122780675 splice site probably benign
R1871:Topaz1 UTSW 9 122799479 missense probably benign 0.18
R1879:Topaz1 UTSW 9 122749619 missense possibly damaging 0.70
R1913:Topaz1 UTSW 9 122767013 missense possibly damaging 0.73
R1977:Topaz1 UTSW 9 122747362 missense unknown
R1989:Topaz1 UTSW 9 122750125 missense possibly damaging 0.86
R2237:Topaz1 UTSW 9 122771147 missense probably benign
R2238:Topaz1 UTSW 9 122771147 missense probably benign
R2239:Topaz1 UTSW 9 122771147 missense probably benign
R3160:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3161:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3162:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3822:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3944:Topaz1 UTSW 9 122750604 missense possibly damaging 0.73
R4571:Topaz1 UTSW 9 122747436 missense probably benign 0.01
R4580:Topaz1 UTSW 9 122747515 missense probably null 0.00
R5043:Topaz1 UTSW 9 122748404 missense probably benign
R5084:Topaz1 UTSW 9 122748818 missense probably benign 0.04
R5234:Topaz1 UTSW 9 122790193 missense possibly damaging 0.82
R5388:Topaz1 UTSW 9 122774093 missense possibly damaging 0.96
R5471:Topaz1 UTSW 9 122791416 splice site probably null
R5706:Topaz1 UTSW 9 122799485 missense possibly damaging 0.53
R5993:Topaz1 UTSW 9 122749039 missense probably benign 0.00
R6104:Topaz1 UTSW 9 122749866 missense probably benign
R6137:Topaz1 UTSW 9 122797756 missense possibly damaging 0.53
R6186:Topaz1 UTSW 9 122748826 missense probably benign 0.33
R6209:Topaz1 UTSW 9 122750505 missense possibly damaging 0.85
R6543:Topaz1 UTSW 9 122748535 missense possibly damaging 0.53
R6548:Topaz1 UTSW 9 122748354 missense possibly damaging 0.53
R6557:Topaz1 UTSW 9 122748895 missense probably benign 0.02
R6636:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6637:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6859:Topaz1 UTSW 9 122801958 missense probably benign 0.33
R7123:Topaz1 UTSW 9 122748415 missense probably damaging 1.00
R7180:Topaz1 UTSW 9 122797705 missense possibly damaging 0.85
R7319:Topaz1 UTSW 9 122750363 missense possibly damaging 0.73
R7743:Topaz1 UTSW 9 122785136 missense probably benign 0.16
R7810:Topaz1 UTSW 9 122749185 missense probably benign 0.18
R7871:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7875:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
R7916:Topaz1 UTSW 9 122747434 missense probably benign 0.05
R8116:Topaz1 UTSW 9 122775643 missense probably benign 0.00
R8437:Topaz1 UTSW 9 122781362 nonsense probably null
X0020:Topaz1 UTSW 9 122774069 missense possibly damaging 0.96
Z1176:Topaz1 UTSW 9 122791494 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGACTTCTGCAATGGAGAGAAG -3'
(R):5'- GATCTGTTCGACCACTGTCTG -3'

Sequencing Primer
(F):5'- GGAGAAAGTTGGAGATTATTGGTC -3'
(R):5'- GTCTGCCTCTGAATATTACCAAC -3'
Posted On2015-04-02