Incidental Mutation 'R3821:Tenm2'
ID 274935
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms D3Bwg1534e, Odz2, 9330187F13Rik, Ten-m2, 2610040L17Rik
MMRRC Submission 040883-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R3821 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 35897483-37126791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35915147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 2129 (I2129N)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057207
AA Change: I2130N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: I2130N

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: I2129N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: I2129N

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: I2129N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: I2129N

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Meta Mutation Damage Score 0.8829 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,301,971 (GRCm39) I332F probably damaging Het
Abcd2 C T 15: 91,058,908 (GRCm39) G512D probably damaging Het
Acp3 G T 9: 104,201,916 (GRCm39) Q76K probably damaging Het
Adamtsl3 G T 7: 82,255,687 (GRCm39) probably benign Het
Alox8 T A 11: 69,077,308 (GRCm39) I481F probably damaging Het
Anp32e A T 3: 95,842,181 (GRCm39) I100L probably benign Het
Arpin G A 7: 79,579,408 (GRCm39) R72C probably damaging Het
C6 A G 15: 4,819,066 (GRCm39) E466G probably benign Het
Ccdc13 C A 9: 121,660,085 (GRCm39) L76F probably damaging Het
Cd44 T C 2: 102,731,738 (GRCm39) probably null Het
Clgn A G 8: 84,147,106 (GRCm39) I353V probably null Het
Cnot6 A T 11: 49,579,999 (GRCm39) S98T probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cramp1 G A 17: 25,193,756 (GRCm39) T908I probably damaging Het
Dnah9 C A 11: 65,741,829 (GRCm39) probably null Het
Ehd3 A T 17: 74,134,390 (GRCm39) I250F probably benign Het
Eml2 T C 7: 18,936,911 (GRCm39) V555A possibly damaging Het
Erbb4 A G 1: 68,345,072 (GRCm39) S550P probably damaging Het
Fchsd1 A G 18: 38,102,510 (GRCm39) probably benign Het
Flad1 T A 3: 89,318,494 (GRCm39) I20F probably damaging Het
Frem2 A T 3: 53,559,836 (GRCm39) L1557Q probably damaging Het
Gbf1 T C 19: 46,253,246 (GRCm39) I506T probably damaging Het
Gm20730 C T 6: 43,058,656 (GRCm39) S52N probably benign Het
Hoxc9 A G 15: 102,890,596 (GRCm39) K171R probably benign Het
Hscb A T 5: 110,984,194 (GRCm39) D52E probably damaging Het
Htr1b A T 9: 81,514,487 (GRCm39) I40N probably benign Het
Ido2 T C 8: 25,023,771 (GRCm39) I356V probably benign Het
Insyn2b T C 11: 34,353,007 (GRCm39) S350P probably benign Het
Irs1 T C 1: 82,267,770 (GRCm39) T149A probably benign Het
Itgam A G 7: 127,711,458 (GRCm39) probably null Het
Itpr2 A T 6: 146,319,224 (GRCm39) H244Q probably damaging Het
Kcnma1 A G 14: 23,417,679 (GRCm39) I846T probably damaging Het
Kdm3a A T 6: 71,588,661 (GRCm39) D449E probably benign Het
Lama1 C A 17: 68,086,041 (GRCm39) probably null Het
Lhfpl4 A G 6: 113,171,069 (GRCm39) V39A probably benign Het
Marf1 A T 16: 13,960,418 (GRCm39) L542Q probably damaging Het
Mns1 A G 9: 72,346,730 (GRCm39) E71G probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrpl19 C A 6: 81,938,987 (GRCm39) E272* probably null Het
Ncoa6 T A 2: 155,248,858 (GRCm39) N1482I probably damaging Het
Neto2 C A 8: 86,389,924 (GRCm39) E180* probably null Het
Or2a51 A G 6: 43,178,604 (GRCm39) T9A probably benign Het
Pcdhga10 A G 18: 37,880,995 (GRCm39) N252S probably damaging Het
Pcdhgb7 C A 18: 37,885,286 (GRCm39) T152K possibly damaging Het
Ptprb G T 10: 116,185,979 (GRCm39) R1678L probably benign Het
Ptprg A T 14: 12,226,375 (GRCm38) I1323L probably benign Het
Rab40b T A 11: 121,248,874 (GRCm39) N127I probably damaging Het
Scn10a A G 9: 119,467,699 (GRCm39) C814R probably benign Het
Sdhb C T 4: 140,706,399 (GRCm39) R279* probably null Het
Shroom4 C T X: 6,536,276 (GRCm39) Q1165* probably null Het
Slc17a4 C T 13: 24,085,752 (GRCm39) R387H probably benign Het
Slc20a2 A G 8: 23,028,918 (GRCm39) I130V probably benign Het
Slitrk3 T C 3: 72,956,549 (GRCm39) Y741C possibly damaging Het
Tas1r1 G T 4: 152,119,138 (GRCm39) L144I probably benign Het
Tmbim1 A G 1: 74,333,089 (GRCm39) V92A probably damaging Het
Tmem131 T A 1: 36,847,477 (GRCm39) H1207L probably damaging Het
Tmem209 G T 6: 30,505,959 (GRCm39) P116T probably damaging Het
Tmem8b C A 4: 43,689,745 (GRCm39) H800N probably damaging Het
Tnfsf8 A G 4: 63,779,127 (GRCm39) V57A probably benign Het
Topaz1 A G 9: 122,626,848 (GRCm39) D1492G possibly damaging Het
Trank1 G A 9: 111,207,887 (GRCm39) G1711R probably damaging Het
Trpc6 A T 9: 8,610,279 (GRCm39) D249V probably damaging Het
Ubr3 G A 2: 69,824,157 (GRCm39) probably null Het
Ufc1 A G 1: 171,117,172 (GRCm39) probably benign Het
Unc5cl T C 17: 48,767,001 (GRCm39) L125P possibly damaging Het
Usb1 G A 8: 96,060,061 (GRCm39) S57N probably benign Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Zfp618 G A 4: 63,051,801 (GRCm39) A861T probably benign Het
Zfp831 T C 2: 174,485,816 (GRCm39) S164P possibly damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36,097,726 (GRCm39) splice site probably benign
IGL00834:Tenm2 APN 11 35,915,085 (GRCm39) missense probably damaging 1.00
IGL00911:Tenm2 APN 11 35,899,560 (GRCm39) nonsense probably null
IGL00937:Tenm2 APN 11 35,915,450 (GRCm39) missense probably damaging 1.00
IGL01154:Tenm2 APN 11 35,932,371 (GRCm39) missense probably damaging 1.00
IGL01313:Tenm2 APN 11 35,915,075 (GRCm39) missense probably damaging 0.98
IGL01346:Tenm2 APN 11 35,918,232 (GRCm39) nonsense probably null
IGL01539:Tenm2 APN 11 35,997,654 (GRCm39) missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36,755,711 (GRCm39) missense probably damaging 0.98
IGL01780:Tenm2 APN 11 35,937,768 (GRCm39) missense probably benign
IGL01821:Tenm2 APN 11 35,914,710 (GRCm39) missense probably damaging 0.98
IGL01988:Tenm2 APN 11 35,918,078 (GRCm39) missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36,097,922 (GRCm39) missense probably benign
IGL02449:Tenm2 APN 11 35,914,449 (GRCm39) missense probably damaging 0.99
IGL02505:Tenm2 APN 11 35,942,743 (GRCm39) nonsense probably null
IGL02649:Tenm2 APN 11 36,097,912 (GRCm39) missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 35,959,285 (GRCm39) missense probably benign 0.05
IGL02801:Tenm2 APN 11 35,937,857 (GRCm39) nonsense probably null
IGL02928:Tenm2 APN 11 35,917,997 (GRCm39) missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 35,932,471 (GRCm39) missense probably damaging 1.00
IGL03202:Tenm2 APN 11 35,915,375 (GRCm39) missense probably damaging 1.00
IGL03213:Tenm2 APN 11 35,914,157 (GRCm39) missense probably benign 0.05
IGL03276:Tenm2 APN 11 35,963,603 (GRCm39) missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 35,942,852 (GRCm39) splice site probably null
IGL03381:Tenm2 APN 11 35,959,238 (GRCm39) missense probably benign 0.01
IGL03398:Tenm2 APN 11 35,915,370 (GRCm39) missense probably damaging 1.00
browser UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
mosaic UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36,164,235 (GRCm39) missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 35,954,729 (GRCm39) missense probably damaging 0.99
R0004:Tenm2 UTSW 11 35,914,184 (GRCm39) missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36,097,951 (GRCm39) splice site probably benign
R0537:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
R0599:Tenm2 UTSW 11 35,915,607 (GRCm39) missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36,834,803 (GRCm39) missense probably damaging 1.00
R0693:Tenm2 UTSW 11 35,915,636 (GRCm39) missense probably damaging 1.00
R0991:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36,755,511 (GRCm39) missense probably benign 0.30
R1177:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 35,899,185 (GRCm39) missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 35,932,486 (GRCm39) missense probably damaging 1.00
R1272:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 35,959,421 (GRCm39) splice site probably benign
R1374:Tenm2 UTSW 11 35,899,281 (GRCm39) missense probably benign 0.00
R1542:Tenm2 UTSW 11 36,191,047 (GRCm39) missense probably damaging 0.99
R1573:Tenm2 UTSW 11 35,937,896 (GRCm39) missense probably damaging 1.00
R1579:Tenm2 UTSW 11 35,997,610 (GRCm39) missense probably damaging 1.00
R1697:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 35,898,930 (GRCm39) missense probably damaging 1.00
R1756:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 35,914,209 (GRCm39) missense probably damaging 0.99
R1950:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 35,938,374 (GRCm39) missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 35,938,091 (GRCm39) nonsense probably null
R2117:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36,755,689 (GRCm39) missense probably damaging 0.98
R2298:Tenm2 UTSW 11 35,937,604 (GRCm39) missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 35,918,018 (GRCm39) missense probably damaging 1.00
R3014:Tenm2 UTSW 11 35,914,800 (GRCm39) missense probably damaging 1.00
R3115:Tenm2 UTSW 11 35,914,193 (GRCm39) missense probably damaging 1.00
R3684:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3685:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3705:Tenm2 UTSW 11 35,959,153 (GRCm39) missense probably damaging 0.97
R3820:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3822:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3844:Tenm2 UTSW 11 35,938,365 (GRCm39) missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36,030,401 (GRCm39) critical splice donor site probably null
R4019:Tenm2 UTSW 11 35,937,901 (GRCm39) missense probably benign 0.04
R4062:Tenm2 UTSW 11 35,899,482 (GRCm39) missense probably damaging 1.00
R4367:Tenm2 UTSW 11 35,918,225 (GRCm39) missense probably benign
R4395:Tenm2 UTSW 11 35,915,451 (GRCm39) missense probably benign 0.23
R4508:Tenm2 UTSW 11 35,899,172 (GRCm39) missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 35,953,931 (GRCm39) missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 35,937,607 (GRCm39) missense probably damaging 1.00
R4644:Tenm2 UTSW 11 35,937,963 (GRCm39) missense probably benign 0.00
R4661:Tenm2 UTSW 11 35,915,275 (GRCm39) missense probably damaging 0.99
R4669:Tenm2 UTSW 11 35,901,314 (GRCm39) missense probably damaging 1.00
R4687:Tenm2 UTSW 11 35,939,924 (GRCm39) missense probably benign
R4711:Tenm2 UTSW 11 36,191,039 (GRCm39) missense probably damaging 0.98
R4816:Tenm2 UTSW 11 35,918,117 (GRCm39) missense probably damaging 1.00
R4843:Tenm2 UTSW 11 35,914,847 (GRCm39) missense probably damaging 1.00
R4850:Tenm2 UTSW 11 35,914,315 (GRCm39) nonsense probably null
R4870:Tenm2 UTSW 11 35,969,396 (GRCm39) missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36,097,907 (GRCm39) missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5073:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5074:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5081:Tenm2 UTSW 11 35,915,460 (GRCm39) missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36,834,989 (GRCm39) missense probably damaging 1.00
R5170:Tenm2 UTSW 11 35,915,633 (GRCm39) missense probably damaging 0.98
R5253:Tenm2 UTSW 11 35,938,028 (GRCm39) nonsense probably null
R5343:Tenm2 UTSW 11 35,960,330 (GRCm39) missense probably benign 0.00
R5493:Tenm2 UTSW 11 36,755,503 (GRCm39) missense probably benign 0.01
R5600:Tenm2 UTSW 11 36,054,541 (GRCm39) splice site probably null
R5677:Tenm2 UTSW 11 36,032,510 (GRCm39) missense probably damaging 0.98
R5703:Tenm2 UTSW 11 35,914,626 (GRCm39) missense probably benign 0.34
R5707:Tenm2 UTSW 11 35,938,009 (GRCm39) missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 35,963,556 (GRCm39) critical splice donor site probably null
R6063:Tenm2 UTSW 11 36,054,544 (GRCm39) critical splice donor site probably null
R6086:Tenm2 UTSW 11 35,899,473 (GRCm39) missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 35,899,610 (GRCm39) missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36,030,517 (GRCm39) missense probably damaging 0.99
R6193:Tenm2 UTSW 11 35,937,621 (GRCm39) missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36,755,686 (GRCm39) missense probably benign 0.44
R6477:Tenm2 UTSW 11 35,901,334 (GRCm39) critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
R6668:Tenm2 UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
R6825:Tenm2 UTSW 11 35,937,711 (GRCm39) missense probably benign 0.02
R6885:Tenm2 UTSW 11 35,914,407 (GRCm39) missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36,062,236 (GRCm39) missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36,054,644 (GRCm39) missense probably damaging 0.99
R7153:Tenm2 UTSW 11 35,915,009 (GRCm39) missense probably damaging 0.98
R7173:Tenm2 UTSW 11 35,932,378 (GRCm39) missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36,062,263 (GRCm39) missense probably damaging 1.00
R7205:Tenm2 UTSW 11 35,939,956 (GRCm39) missense probably damaging 0.99
R7250:Tenm2 UTSW 11 35,963,625 (GRCm39) missense probably damaging 1.00
R7290:Tenm2 UTSW 11 35,914,298 (GRCm39) missense probably damaging 1.00
R7366:Tenm2 UTSW 11 35,960,241 (GRCm39) missense probably benign 0.09
R7432:Tenm2 UTSW 11 36,755,768 (GRCm39) missense probably benign
R7504:Tenm2 UTSW 11 36,030,570 (GRCm39) missense probably damaging 1.00
R7513:Tenm2 UTSW 11 35,942,727 (GRCm39) missense probably benign 0.34
R7523:Tenm2 UTSW 11 35,969,408 (GRCm39) splice site probably null
R7527:Tenm2 UTSW 11 36,097,803 (GRCm39) missense probably damaging 1.00
R7648:Tenm2 UTSW 11 35,997,563 (GRCm39) missense probably damaging 1.00
R7653:Tenm2 UTSW 11 35,938,174 (GRCm39) missense probably benign 0.09
R7717:Tenm2 UTSW 11 36,755,762 (GRCm39) missense probably damaging 0.97
R7739:Tenm2 UTSW 11 35,960,388 (GRCm39) missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 35,914,133 (GRCm39) missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 35,901,276 (GRCm39) missense probably damaging 0.99
R7803:Tenm2 UTSW 11 35,937,943 (GRCm39) missense probably damaging 0.98
R7834:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R7838:Tenm2 UTSW 11 35,997,626 (GRCm39) missense probably benign 0.02
R8073:Tenm2 UTSW 11 36,030,471 (GRCm39) missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 35,918,048 (GRCm39) missense probably benign 0.23
R8109:Tenm2 UTSW 11 35,899,137 (GRCm39) missense probably benign
R8306:Tenm2 UTSW 11 35,960,196 (GRCm39) missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8452:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8864:Tenm2 UTSW 11 35,918,022 (GRCm39) missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 35,942,788 (GRCm39) missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36,834,861 (GRCm39) missense probably damaging 0.98
R8969:Tenm2 UTSW 11 35,942,688 (GRCm39) missense probably damaging 0.99
R9168:Tenm2 UTSW 11 35,930,722 (GRCm39) missense probably damaging 1.00
R9279:Tenm2 UTSW 11 35,959,303 (GRCm39) missense probably benign 0.00
R9294:Tenm2 UTSW 11 35,915,327 (GRCm39) missense probably damaging 0.98
R9320:Tenm2 UTSW 11 35,914,474 (GRCm39) missense probably damaging 0.99
R9373:Tenm2 UTSW 11 35,930,713 (GRCm39) missense probably damaging 1.00
R9408:Tenm2 UTSW 11 35,960,246 (GRCm39) missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36,032,396 (GRCm39) missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36,112,286 (GRCm39) missense probably benign
R9489:Tenm2 UTSW 11 36,834,791 (GRCm39) missense probably damaging 0.99
R9711:Tenm2 UTSW 11 35,915,341 (GRCm39) missense probably damaging 0.99
RF021:Tenm2 UTSW 11 35,915,030 (GRCm39) missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 35,915,027 (GRCm39) missense probably damaging 1.00
X0063:Tenm2 UTSW 11 35,915,557 (GRCm39) missense probably benign
Z1088:Tenm2 UTSW 11 36,164,094 (GRCm39) missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36,191,162 (GRCm39) missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 35,899,061 (GRCm39) missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36,275,957 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATTGACGGCCACACTCTG -3'
(R):5'- GGAATGATCAACGCCAGGTTTG -3'

Sequencing Primer
(F):5'- GTCCCCGTCATAGTCATAGGTG -3'
(R):5'- CAACGCCAGGTTTGATTATACC -3'
Posted On 2015-04-02