Incidental Mutation 'R3821:Aarsd1'
ID274939
Institutional Source Beutler Lab
Gene Symbol Aarsd1
Ensembl Gene ENSMUSG00000075528
Gene Namealanyl-tRNA synthetase domain containing 1
Synonyms2310044P18Rik
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101406839-101417615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101411145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 332 (I332F)
Ref Sequence ENSEMBL: ENSMUSP00000102880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070395] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably damaging
Transcript: ENSMUST00000070395
AA Change: I201F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528
AA Change: I201F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107257
AA Change: I314F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239
AA Change: I314F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107259
AA Change: I332F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239
AA Change: I332F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189049
Meta Mutation Damage Score 0.7730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Aarsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Aarsd1 APN 11 101417359 nonsense probably null
R0462:Aarsd1 UTSW 11 101414091 missense probably damaging 1.00
R1885:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1886:Aarsd1 UTSW 11 101411401 missense probably benign 0.33
R1909:Aarsd1 UTSW 11 101410231 intron probably null
R2382:Aarsd1 UTSW 11 101414078 missense probably damaging 0.99
R3820:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R3822:Aarsd1 UTSW 11 101411145 missense probably damaging 1.00
R4034:Aarsd1 UTSW 11 101411332 missense probably damaging 1.00
R4701:Aarsd1 UTSW 11 101411160 missense probably benign 0.00
R5204:Aarsd1 UTSW 11 101406926 missense probably damaging 1.00
R5327:Aarsd1 UTSW 11 101410377 missense probably benign 0.30
R5554:Aarsd1 UTSW 11 101413981 missense probably benign 0.01
R7342:Aarsd1 UTSW 11 101417192 missense probably benign 0.00
R7574:Aarsd1 UTSW 11 101411144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAGGACACAAGGGCAAG -3'
(R):5'- TGAGTGTTCGAGAGCTGAGC -3'

Sequencing Primer
(F):5'- GGCAAGAGAGACCAGACCC -3'
(R):5'- TGAGCCTGGATGACCCTGAG -3'
Posted On2015-04-02