Incidental Mutation 'R3821:Ptprg'
ID274944
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Nameprotein tyrosine phosphatase, receptor type, G
Synonyms5430405N12Rik, RPTPgamma
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location11553532-12242041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12226375 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1323 (I1323L)
Ref Sequence ENSEMBL: ENSMUSP00000022264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]
Predicted Effect probably benign
Transcript: ENSMUST00000022264
AA Change: I1323L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: I1323L

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119888
AA Change: I548L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: I548L

DomainStartEndE-ValueType
PTPc 69 343 1.76e-136 SMART
PTPc 371 634 1.32e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134290
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2125:Ptprg UTSW 14 12179283 missense possibly damaging 0.74
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4825:Ptprg UTSW 14 12220654 missense probably damaging 1.00
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4972:Ptprg UTSW 14 12226427 missense possibly damaging 0.94
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7709:Ptprg UTSW 14 12226452 missense probably damaging 1.00
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGGTCTTCTGTAATCTGGGCAAC -3'
(R):5'- CCACAACCCTTTTGCACATG -3'

Sequencing Primer
(F):5'- GGCAACCCAACACTGTTCAGTTTC -3'
(R):5'- GTATGTCCACACTACAAGTAACATGG -3'
Posted On2015-04-02