Incidental Mutation 'R3821:C6'
ID274946
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Namecomplement component 6
Synonyms
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4727175-4814967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4789584 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 466 (E466G)
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000162350] [ENSMUST00000162585]
Predicted Effect probably benign
Transcript: ENSMUST00000022788
AA Change: E466G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181
AA Change: E466G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162350
AA Change: E466G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181
AA Change: E466G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162585
AA Change: E466G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181
AA Change: E466G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162729
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Abcd2 C T 15: 91,174,705 G512D probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4759967 missense possibly damaging 0.53
IGL00918:C6 APN 15 4735257 missense possibly damaging 0.90
IGL01615:C6 APN 15 4781896 missense probably benign 0.00
IGL01637:C6 APN 15 4759917 missense possibly damaging 0.69
IGL01662:C6 APN 15 4792754 missense probably damaging 1.00
IGL02293:C6 APN 15 4755303 missense probably benign 0.01
IGL02431:C6 APN 15 4759861 nonsense probably null
IGL02568:C6 APN 15 4791164 nonsense probably null
IGL02688:C6 APN 15 4798320 missense probably benign 0.00
IGL02737:C6 APN 15 4796914 missense probably benign 0.30
R0195:C6 UTSW 15 4763471 missense probably benign 0.01
R0334:C6 UTSW 15 4755367 missense probably benign 0.24
R0879:C6 UTSW 15 4763336 splice site probably benign
R0940:C6 UTSW 15 4735235 missense probably benign 0.12
R1342:C6 UTSW 15 4739749 splice site probably benign
R1649:C6 UTSW 15 4735257 missense possibly damaging 0.90
R1709:C6 UTSW 15 4790970 missense probably benign 0.34
R1967:C6 UTSW 15 4759820 missense probably damaging 0.99
R2068:C6 UTSW 15 4791070 missense probably damaging 1.00
R3056:C6 UTSW 15 4739873 missense probably damaging 0.99
R3791:C6 UTSW 15 4735235 missense probably benign 0.00
R3895:C6 UTSW 15 4808470 missense probably benign 0.00
R4178:C6 UTSW 15 4735139 missense probably benign 0.02
R4440:C6 UTSW 15 4735251 missense possibly damaging 0.90
R4598:C6 UTSW 15 4763370 missense possibly damaging 0.55
R4632:C6 UTSW 15 4759868 missense probably benign 0.01
R4756:C6 UTSW 15 4781912 missense probably benign
R4879:C6 UTSW 15 4803647 splice site probably null
R5452:C6 UTSW 15 4814829 missense possibly damaging 0.51
R5538:C6 UTSW 15 4814829 missense possibly damaging 0.84
R5547:C6 UTSW 15 4808488 missense probably benign 0.00
R5790:C6 UTSW 15 4763486 missense probably damaging 1.00
R5862:C6 UTSW 15 4735263 missense possibly damaging 0.66
R5946:C6 UTSW 15 4808514 missense possibly damaging 0.96
R6049:C6 UTSW 15 4735172 missense probably damaging 1.00
R6247:C6 UTSW 15 4763541 missense probably damaging 1.00
R6438:C6 UTSW 15 4796983 missense possibly damaging 0.94
R6873:C6 UTSW 15 4790979 missense probably benign 0.03
R7052:C6 UTSW 15 4733695 missense probably damaging 0.97
R7302:C6 UTSW 15 4796950 missense probably damaging 1.00
R7361:C6 UTSW 15 4796922 nonsense probably null
R7481:C6 UTSW 15 4814875 missense
R7492:C6 UTSW 15 4731714 missense probably benign 0.00
R7498:C6 UTSW 15 4763364 missense probably damaging 1.00
R7569:C6 UTSW 15 4789581 missense probably benign 0.01
R7653:C6 UTSW 15 4814762 missense
R7666:C6 UTSW 15 4789505 missense probably damaging 0.99
R7843:C6 UTSW 15 4808404 missense
R8073:C6 UTSW 15 4735193 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGACCTGACTGTGCTATCTAC -3'
(R):5'- TCACGACTGTATATTGAAAGCAGAC -3'

Sequencing Primer
(F):5'- GCCCTCCTGAGAAAATTGACTTG -3'
(R):5'- CATGCACTTTGGGCTGAT -3'
Posted On2015-04-02