Incidental Mutation 'R3821:Abcd2'
ID274948
Institutional Source Beutler Lab
Gene Symbol Abcd2
Ensembl Gene ENSMUSG00000055782
Gene NameATP-binding cassette, sub-family D (ALD), member 2
SynonymsABC39, adrenoleukodystrophy related, ALDL1, ALDR
MMRRC Submission 040883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3821 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91145871-91191799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91174705 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 512 (G512D)
Ref Sequence ENSEMBL: ENSMUSP00000068940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069511]
Predicted Effect probably damaging
Transcript: ENSMUST00000069511
AA Change: G512D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068940
Gene: ENSMUSG00000055782
AA Change: G512D

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Pfam:ABC_membrane_2 78 365 1.9e-110 PFAM
AAA 504 690 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229909
Meta Mutation Damage Score 0.9747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene exhibit a late-onset cerebellar and sensory ataxia, loss of Purkinje cells, dorsal root ganglia cell degeneration, axonal degeneration in the spinal cord, and an accumulation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,411,145 I332F probably damaging Het
Acpp G T 9: 104,324,717 Q76K probably damaging Het
Adamtsl3 G T 7: 82,606,479 probably benign Het
Alox8 T A 11: 69,186,482 I481F probably damaging Het
Anp32e A T 3: 95,934,869 I100L probably benign Het
Arpin G A 7: 79,929,660 R72C probably damaging Het
C6 A G 15: 4,789,584 E466G probably benign Het
Ccdc13 C A 9: 121,831,019 L76F probably damaging Het
Cd44 T C 2: 102,901,393 probably null Het
Clgn A G 8: 83,420,477 I353V probably null Het
Cnot6 A T 11: 49,689,172 S98T probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cramp1l G A 17: 24,974,782 T908I probably damaging Het
Dnah9 C A 11: 65,851,003 probably null Het
Ehd3 A T 17: 73,827,395 I250F probably benign Het
Eml2 T C 7: 19,202,986 V555A possibly damaging Het
Erbb4 A G 1: 68,305,913 S550P probably damaging Het
Fam196b T C 11: 34,403,007 S350P probably benign Het
Fchsd1 A G 18: 37,969,457 probably benign Het
Flad1 T A 3: 89,411,187 I20F probably damaging Het
Frem2 A T 3: 53,652,415 L1557Q probably damaging Het
Gbf1 T C 19: 46,264,807 I506T probably damaging Het
Gm20730 C T 6: 43,081,722 S52N probably benign Het
Hoxc9 A G 15: 102,982,164 K171R probably benign Het
Hscb A T 5: 110,836,328 D52E probably damaging Het
Htr1b A T 9: 81,632,434 I40N probably benign Het
Ido2 T C 8: 24,533,755 I356V probably benign Het
Irs1 T C 1: 82,290,049 T149A probably benign Het
Itgam A G 7: 128,112,286 probably null Het
Itpr2 A T 6: 146,417,726 H244Q probably damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdm3a A T 6: 71,611,677 D449E probably benign Het
Lama1 C A 17: 67,779,046 probably null Het
Lhfpl4 A G 6: 113,194,108 V39A probably benign Het
Marf1 A T 16: 14,142,554 L542Q probably damaging Het
Mns1 A G 9: 72,439,448 E71G probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrpl19 C A 6: 81,962,006 E272* probably null Het
Ncoa6 T A 2: 155,406,938 N1482I probably damaging Het
Neto2 C A 8: 85,663,295 E180* probably null Het
Olfr435 A G 6: 43,201,670 T9A probably benign Het
Pcdhga10 A G 18: 37,747,942 N252S probably damaging Het
Pcdhgb7 C A 18: 37,752,233 T152K possibly damaging Het
Ptprb G T 10: 116,350,074 R1678L probably benign Het
Ptprg A T 14: 12,226,375 I1323L probably benign Het
Rab40b T A 11: 121,358,048 N127I probably damaging Het
Scn10a A G 9: 119,638,633 C814R probably benign Het
Sdhb C T 4: 140,979,088 R279* probably null Het
Shroom4 C T X: 6,624,222 Q1165* probably null Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc20a2 A G 8: 22,538,902 I130V probably benign Het
Slitrk3 T C 3: 73,049,216 Y741C possibly damaging Het
Tas1r1 G T 4: 152,034,681 L144I probably benign Het
Tenm2 A T 11: 36,024,320 I2129N probably damaging Het
Tmbim1 A G 1: 74,293,930 V92A probably damaging Het
Tmem131 T A 1: 36,808,396 H1207L probably damaging Het
Tmem209 G T 6: 30,505,960 P116T probably damaging Het
Tmem8b C A 4: 43,689,745 H800N probably damaging Het
Tnfsf8 A G 4: 63,860,890 V57A probably benign Het
Topaz1 A G 9: 122,797,783 D1492G possibly damaging Het
Trank1 G A 9: 111,378,819 G1711R probably damaging Het
Trpc6 A T 9: 8,610,278 D249V probably damaging Het
Ubr3 G A 2: 69,993,813 probably null Het
Ufc1 A G 1: 171,289,599 probably benign Het
Unc5cl T C 17: 48,459,973 L125P possibly damaging Het
Usb1 G A 8: 95,333,433 S57N probably benign Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Abcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Abcd2 APN 15 91149213 splice site probably benign
IGL01515:Abcd2 APN 15 91163086 missense probably damaging 1.00
IGL01733:Abcd2 APN 15 91191614 utr 5 prime probably benign
IGL02084:Abcd2 APN 15 91178327 critical splice acceptor site probably null
IGL02408:Abcd2 APN 15 91178241 missense possibly damaging 0.95
IGL02568:Abcd2 APN 15 91148981 utr 3 prime probably benign
IGL02942:Abcd2 APN 15 91149175 missense probably damaging 0.99
IGL03281:Abcd2 APN 15 91151673 missense probably damaging 1.00
R0463:Abcd2 UTSW 15 91159124 missense probably benign 0.01
R1226:Abcd2 UTSW 15 91191043 missense probably benign
R1510:Abcd2 UTSW 15 91188978 missense probably damaging 1.00
R1581:Abcd2 UTSW 15 91179144 missense probably benign
R1802:Abcd2 UTSW 15 91163102 missense probably benign
R1918:Abcd2 UTSW 15 91191481 missense probably benign
R2184:Abcd2 UTSW 15 91191439 missense probably benign
R3820:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R4486:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4487:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4489:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4706:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4707:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4727:Abcd2 UTSW 15 91178286 missense probably benign 0.33
R4872:Abcd2 UTSW 15 91191311 missense probably benign
R4971:Abcd2 UTSW 15 91163110 missense probably benign 0.06
R5492:Abcd2 UTSW 15 91188973 missense probably benign
R6049:Abcd2 UTSW 15 91178236 missense probably benign 0.00
R6143:Abcd2 UTSW 15 91190947 missense possibly damaging 0.95
R6177:Abcd2 UTSW 15 91190693 missense probably damaging 0.99
R6566:Abcd2 UTSW 15 91191118 missense probably damaging 1.00
R7108:Abcd2 UTSW 15 91191274 missense probably benign 0.43
R7208:Abcd2 UTSW 15 91190682 nonsense probably null
R7212:Abcd2 UTSW 15 91159123 missense possibly damaging 0.84
R7497:Abcd2 UTSW 15 91191176 missense probably benign
R7505:Abcd2 UTSW 15 91149057 missense possibly damaging 0.60
R7732:Abcd2 UTSW 15 91191248 missense possibly damaging 0.64
R8119:Abcd2 UTSW 15 91148994 missense probably benign 0.00
R8203:Abcd2 UTSW 15 91191166 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAACCCGAAGAGCCTGAG -3'
(R):5'- AGATCTCAGTTGAAGTGTTGTAGAG -3'

Sequencing Primer
(F):5'- CCCGAAGAGCCTGAGAAACG -3'
(R):5'- GCTACTTTTAGCTTCAGAGAATAGTC -3'
Posted On2015-04-02