Incidental Mutation 'R3821:Cramp1'
ID 274951
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 040883-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3821 (G1)
Quality Score 170
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25193756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 908 (T908I)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: T908I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: T908I

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.1937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,301,971 (GRCm39) I332F probably damaging Het
Abcd2 C T 15: 91,058,908 (GRCm39) G512D probably damaging Het
Acp3 G T 9: 104,201,916 (GRCm39) Q76K probably damaging Het
Adamtsl3 G T 7: 82,255,687 (GRCm39) probably benign Het
Alox8 T A 11: 69,077,308 (GRCm39) I481F probably damaging Het
Anp32e A T 3: 95,842,181 (GRCm39) I100L probably benign Het
Arpin G A 7: 79,579,408 (GRCm39) R72C probably damaging Het
C6 A G 15: 4,819,066 (GRCm39) E466G probably benign Het
Ccdc13 C A 9: 121,660,085 (GRCm39) L76F probably damaging Het
Cd44 T C 2: 102,731,738 (GRCm39) probably null Het
Clgn A G 8: 84,147,106 (GRCm39) I353V probably null Het
Cnot6 A T 11: 49,579,999 (GRCm39) S98T probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Dnah9 C A 11: 65,741,829 (GRCm39) probably null Het
Ehd3 A T 17: 74,134,390 (GRCm39) I250F probably benign Het
Eml2 T C 7: 18,936,911 (GRCm39) V555A possibly damaging Het
Erbb4 A G 1: 68,345,072 (GRCm39) S550P probably damaging Het
Fchsd1 A G 18: 38,102,510 (GRCm39) probably benign Het
Flad1 T A 3: 89,318,494 (GRCm39) I20F probably damaging Het
Frem2 A T 3: 53,559,836 (GRCm39) L1557Q probably damaging Het
Gbf1 T C 19: 46,253,246 (GRCm39) I506T probably damaging Het
Gm20730 C T 6: 43,058,656 (GRCm39) S52N probably benign Het
Hoxc9 A G 15: 102,890,596 (GRCm39) K171R probably benign Het
Hscb A T 5: 110,984,194 (GRCm39) D52E probably damaging Het
Htr1b A T 9: 81,514,487 (GRCm39) I40N probably benign Het
Ido2 T C 8: 25,023,771 (GRCm39) I356V probably benign Het
Insyn2b T C 11: 34,353,007 (GRCm39) S350P probably benign Het
Irs1 T C 1: 82,267,770 (GRCm39) T149A probably benign Het
Itgam A G 7: 127,711,458 (GRCm39) probably null Het
Itpr2 A T 6: 146,319,224 (GRCm39) H244Q probably damaging Het
Kcnma1 A G 14: 23,417,679 (GRCm39) I846T probably damaging Het
Kdm3a A T 6: 71,588,661 (GRCm39) D449E probably benign Het
Lama1 C A 17: 68,086,041 (GRCm39) probably null Het
Lhfpl4 A G 6: 113,171,069 (GRCm39) V39A probably benign Het
Marf1 A T 16: 13,960,418 (GRCm39) L542Q probably damaging Het
Mns1 A G 9: 72,346,730 (GRCm39) E71G probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrpl19 C A 6: 81,938,987 (GRCm39) E272* probably null Het
Ncoa6 T A 2: 155,248,858 (GRCm39) N1482I probably damaging Het
Neto2 C A 8: 86,389,924 (GRCm39) E180* probably null Het
Or2a51 A G 6: 43,178,604 (GRCm39) T9A probably benign Het
Pcdhga10 A G 18: 37,880,995 (GRCm39) N252S probably damaging Het
Pcdhgb7 C A 18: 37,885,286 (GRCm39) T152K possibly damaging Het
Ptprb G T 10: 116,185,979 (GRCm39) R1678L probably benign Het
Ptprg A T 14: 12,226,375 (GRCm38) I1323L probably benign Het
Rab40b T A 11: 121,248,874 (GRCm39) N127I probably damaging Het
Scn10a A G 9: 119,467,699 (GRCm39) C814R probably benign Het
Sdhb C T 4: 140,706,399 (GRCm39) R279* probably null Het
Shroom4 C T X: 6,536,276 (GRCm39) Q1165* probably null Het
Slc17a4 C T 13: 24,085,752 (GRCm39) R387H probably benign Het
Slc20a2 A G 8: 23,028,918 (GRCm39) I130V probably benign Het
Slitrk3 T C 3: 72,956,549 (GRCm39) Y741C possibly damaging Het
Tas1r1 G T 4: 152,119,138 (GRCm39) L144I probably benign Het
Tenm2 A T 11: 35,915,147 (GRCm39) I2129N probably damaging Het
Tmbim1 A G 1: 74,333,089 (GRCm39) V92A probably damaging Het
Tmem131 T A 1: 36,847,477 (GRCm39) H1207L probably damaging Het
Tmem209 G T 6: 30,505,959 (GRCm39) P116T probably damaging Het
Tmem8b C A 4: 43,689,745 (GRCm39) H800N probably damaging Het
Tnfsf8 A G 4: 63,779,127 (GRCm39) V57A probably benign Het
Topaz1 A G 9: 122,626,848 (GRCm39) D1492G possibly damaging Het
Trank1 G A 9: 111,207,887 (GRCm39) G1711R probably damaging Het
Trpc6 A T 9: 8,610,279 (GRCm39) D249V probably damaging Het
Ubr3 G A 2: 69,824,157 (GRCm39) probably null Het
Ufc1 A G 1: 171,117,172 (GRCm39) probably benign Het
Unc5cl T C 17: 48,767,001 (GRCm39) L125P possibly damaging Het
Usb1 G A 8: 96,060,061 (GRCm39) S57N probably benign Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Zfp618 G A 4: 63,051,801 (GRCm39) A861T probably benign Het
Zfp831 T C 2: 174,485,816 (GRCm39) S164P possibly damaging Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCATAGTGGCAGCTAGATGC -3'
(R):5'- CCTTGGAAAAGGTCTTATTCCCATC -3'

Sequencing Primer
(F):5'- CAGAGGTATGCTAGAAATGTCATAC -3'
(R):5'- CCTCCTGGTTGACAGTTA -3'
Posted On 2015-04-02