Incidental Mutation 'R3807:Eri2'
ID 274974
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Name exoribonuclease 2
Synonyms Exod1, 4933424N09Rik
MMRRC Submission 040764-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R3807 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119383049-119393283 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 119385231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 423 (C423*)
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000150844] [ENSMUST00000139192]
AlphaFold Q5BKS4
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect probably null
Transcript: ENSMUST00000150844
AA Change: C423*
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929
AA Change: C423*

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154828
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 112,717,002 (GRCm39) W2R probably damaging Het
Arhgap42 A G 9: 9,008,034 (GRCm39) I563T probably damaging Het
Armcx1 T C X: 133,622,014 (GRCm39) V372A probably damaging Het
Bicd1 T A 6: 149,420,489 (GRCm39) L780M probably damaging Het
Bpifb1 C A 2: 154,055,922 (GRCm39) N329K probably benign Het
Ccdc113 A T 8: 96,269,281 (GRCm39) N193I probably damaging Het
Cebpz A T 17: 79,242,847 (GRCm39) L269Q probably damaging Het
Cttn C T 7: 143,999,588 (GRCm39) V290M probably damaging Het
Ctu1 T C 7: 43,326,097 (GRCm39) L252P probably damaging Het
Dmbt1 T A 7: 130,713,819 (GRCm39) M1455K possibly damaging Het
Eme1 A G 11: 94,541,418 (GRCm39) W135R probably damaging Het
Entpd7 T G 19: 43,713,979 (GRCm39) probably null Het
Erich1 T C 8: 14,083,695 (GRCm39) N125S probably benign Het
Fam149a T A 8: 45,834,647 (GRCm39) T51S possibly damaging Het
Fer1l4 C T 2: 155,887,603 (GRCm39) G531D probably damaging Het
Frem2 A T 3: 53,560,870 (GRCm39) D1212E probably benign Het
Garin3 G A 11: 46,295,780 (GRCm39) A51T possibly damaging Het
Get4 G T 5: 139,238,286 (GRCm39) V23F probably damaging Het
Gm11595 C T 11: 99,663,380 (GRCm39) R100H unknown Het
Gria1 T C 11: 57,201,504 (GRCm39) W712R probably damaging Het
Herc2 A G 7: 55,857,557 (GRCm39) N4047D probably damaging Het
Hoxc9 A G 15: 102,890,116 (GRCm39) Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,066,661 (GRCm39) probably null Het
Lrrc56 A G 7: 140,789,298 (GRCm39) T393A probably benign Het
Lrrc7 T C 3: 157,891,130 (GRCm39) I346V probably benign Het
Med14 T C X: 12,553,416 (GRCm39) Y463C probably damaging Het
Nalcn T A 14: 123,515,599 (GRCm39) D1734V probably damaging Het
Nfe2l3 A T 6: 51,434,357 (GRCm39) R306* probably null Het
Nolc1 CAG CAGAAG 19: 46,069,798 (GRCm39) probably benign Het
Nolc1 CAG CAGAAG 19: 46,069,810 (GRCm39) probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,069,791 (GRCm39) probably benign Het
Npr1 A T 3: 90,366,033 (GRCm39) V586E probably damaging Het
Or2d2b A G 7: 106,705,670 (GRCm39) S133P probably benign Het
Or5h24 A C 16: 58,919,206 (GRCm39) *50G probably null Het
Pcdhb4 T C 18: 37,442,367 (GRCm39) F559S probably damaging Het
Psmd12 T G 11: 107,386,591 (GRCm39) D387E probably benign Het
Psme4 T A 11: 30,806,027 (GRCm39) probably null Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rgs11 A T 17: 26,422,474 (GRCm39) I69F probably damaging Het
Ryr1 C T 7: 28,719,577 (GRCm39) A4277T probably damaging Het
Setbp1 C T 18: 78,826,537 (GRCm39) V1359I probably benign Het
Sis A T 3: 72,832,929 (GRCm39) V956E probably benign Het
Slc35f3 T A 8: 127,115,978 (GRCm39) W302R probably damaging Het
Syt16 A G 12: 74,276,172 (GRCm39) E212G possibly damaging Het
Tdp2 C A 13: 25,015,776 (GRCm39) S21* probably null Het
Tfrc A T 16: 32,435,644 (GRCm39) N173I possibly damaging Het
Tmem132b A T 5: 125,864,644 (GRCm39) I917F probably damaging Het
Vbp1 T C X: 74,566,948 (GRCm39) V122A probably damaging Het
Vmn1r225 G A 17: 20,723,114 (GRCm39) W185* probably null Het
Vmn1r70 A G 7: 10,367,715 (GRCm39) T68A probably benign Het
Zfp518a A G 19: 40,903,241 (GRCm39) K1057E possibly damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119,386,964 (GRCm39) missense probably benign 0.44
IGL00987:Eri2 APN 7 119,390,389 (GRCm39) missense probably damaging 1.00
IGL01139:Eri2 APN 7 119,385,960 (GRCm39) critical splice donor site probably null
IGL01476:Eri2 APN 7 119,389,472 (GRCm39) missense probably damaging 1.00
IGL02019:Eri2 APN 7 119,385,303 (GRCm39) nonsense probably null
IGL02208:Eri2 APN 7 119,385,158 (GRCm39) missense probably benign 0.00
IGL02395:Eri2 APN 7 119,387,033 (GRCm39) missense probably damaging 0.98
IGL02405:Eri2 APN 7 119,384,705 (GRCm39) missense probably damaging 1.00
IGL02646:Eri2 APN 7 119,385,331 (GRCm39) missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119,386,665 (GRCm39) missense probably damaging 0.98
alien UTSW 7 119,390,397 (GRCm39) missense probably damaging 1.00
extraterrestrial UTSW 7 119,393,139 (GRCm39) critical splice donor site probably null
G5030:Eri2 UTSW 7 119,385,601 (GRCm39) missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119,384,494 (GRCm39) missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119,385,524 (GRCm39) missense probably benign 0.00
R0152:Eri2 UTSW 7 119,389,606 (GRCm39) missense probably damaging 1.00
R0378:Eri2 UTSW 7 119,393,139 (GRCm39) critical splice donor site probably null
R0532:Eri2 UTSW 7 119,385,206 (GRCm39) missense probably benign 0.22
R0630:Eri2 UTSW 7 119,385,640 (GRCm39) missense probably benign 0.27
R1192:Eri2 UTSW 7 119,391,540 (GRCm39) missense probably damaging 1.00
R1416:Eri2 UTSW 7 119,390,397 (GRCm39) missense probably damaging 1.00
R1884:Eri2 UTSW 7 119,390,346 (GRCm39) missense probably benign 0.12
R2173:Eri2 UTSW 7 119,385,766 (GRCm39) missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119,384,567 (GRCm39) missense probably benign
R3805:Eri2 UTSW 7 119,385,231 (GRCm39) nonsense probably null
R4534:Eri2 UTSW 7 119,389,466 (GRCm39) missense probably damaging 1.00
R4738:Eri2 UTSW 7 119,386,955 (GRCm39) critical splice donor site probably null
R4776:Eri2 UTSW 7 119,384,169 (GRCm39) utr 3 prime probably benign
R4780:Eri2 UTSW 7 119,384,903 (GRCm39) missense probably benign 0.43
R5037:Eri2 UTSW 7 119,384,897 (GRCm39) missense probably benign
R5260:Eri2 UTSW 7 119,387,069 (GRCm39) splice site probably benign
R5315:Eri2 UTSW 7 119,385,241 (GRCm39) missense probably benign 0.00
R5884:Eri2 UTSW 7 119,371,552 (GRCm39) makesense probably null
R5927:Eri2 UTSW 7 119,385,291 (GRCm39) missense probably damaging 1.00
R6937:Eri2 UTSW 7 119,386,012 (GRCm39) missense probably damaging 0.96
R7296:Eri2 UTSW 7 119,385,739 (GRCm39) nonsense probably null
R7302:Eri2 UTSW 7 119,386,009 (GRCm39) missense probably benign 0.38
R7480:Eri2 UTSW 7 119,385,734 (GRCm39) nonsense probably null
R7494:Eri2 UTSW 7 119,385,304 (GRCm39) missense probably damaging 0.99
R7524:Eri2 UTSW 7 119,384,972 (GRCm39) missense probably benign 0.00
R8187:Eri2 UTSW 7 119,384,767 (GRCm39) missense probably damaging 1.00
R8373:Eri2 UTSW 7 119,371,820 (GRCm39) missense probably benign 0.02
R8551:Eri2 UTSW 7 119,387,062 (GRCm39) splice site probably null
R9710:Eri2 UTSW 7 119,384,824 (GRCm39) missense probably benign
R9720:Eri2 UTSW 7 119,386,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCGAACCTGGGTGTTTG -3'
(R):5'- GTAAAAGTGATCAGCTTGCACTG -3'

Sequencing Primer
(F):5'- CATCATAGACTGTACTGTGAGGACTC -3'
(R):5'- TGAATGACAGCTCAAAGTCCTC -3'
Posted On 2015-04-02