Incidental Mutation 'R3807:Eri2'
ID274974
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Nameexoribonuclease 2
Synonyms4933424N09Rik, Exod1
MMRRC Submission 040764-MU
Accession Numbers

Genbank: NM_027698

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119768679-119794058 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119786008 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 423 (C423*)
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133926
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect probably null
Transcript: ENSMUST00000150844
AA Change: C423*
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929
AA Change: C423*

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154828
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119787741 missense probably benign 0.44
IGL00987:Eri2 APN 7 119791166 missense probably damaging 1.00
IGL01139:Eri2 APN 7 119786737 critical splice donor site probably null
IGL01476:Eri2 APN 7 119790249 missense probably damaging 1.00
IGL02019:Eri2 APN 7 119786080 nonsense probably null
IGL02208:Eri2 APN 7 119785935 missense probably benign 0.00
IGL02395:Eri2 APN 7 119787810 missense probably damaging 0.98
IGL02405:Eri2 APN 7 119785482 missense probably damaging 1.00
IGL02646:Eri2 APN 7 119786108 missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119787442 missense probably damaging 0.98
alien UTSW 7 119791174 missense probably damaging 1.00
extraterrestrial UTSW 7 119793916 critical splice donor site probably null
G5030:Eri2 UTSW 7 119786378 missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119785271 missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119786301 missense probably benign 0.00
R0152:Eri2 UTSW 7 119790383 missense probably damaging 1.00
R0378:Eri2 UTSW 7 119793916 critical splice donor site probably null
R0532:Eri2 UTSW 7 119785983 missense probably benign 0.22
R0630:Eri2 UTSW 7 119786417 missense probably benign 0.27
R1192:Eri2 UTSW 7 119792317 missense probably damaging 1.00
R1416:Eri2 UTSW 7 119791174 missense probably damaging 1.00
R1884:Eri2 UTSW 7 119791123 missense probably benign 0.12
R2173:Eri2 UTSW 7 119786543 missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119785344 missense probably benign
R3805:Eri2 UTSW 7 119786008 nonsense probably null
R4534:Eri2 UTSW 7 119790243 missense probably damaging 1.00
R4738:Eri2 UTSW 7 119787732 critical splice donor site probably null
R4776:Eri2 UTSW 7 119784946 utr 3 prime probably benign
R4780:Eri2 UTSW 7 119785680 missense probably benign 0.43
R5037:Eri2 UTSW 7 119785674 missense probably benign
R5260:Eri2 UTSW 7 119787846 splice site probably benign
R5315:Eri2 UTSW 7 119786018 missense probably benign 0.00
R5884:Eri2 UTSW 7 119772329 makesense probably null
R5927:Eri2 UTSW 7 119786068 missense probably damaging 1.00
R6937:Eri2 UTSW 7 119786789 missense probably damaging 0.96
R7296:Eri2 UTSW 7 119786516 nonsense probably null
R7302:Eri2 UTSW 7 119786786 missense probably benign 0.38
R7480:Eri2 UTSW 7 119786511 nonsense probably null
R7494:Eri2 UTSW 7 119786081 missense probably damaging 0.99
R7524:Eri2 UTSW 7 119785749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCCGAACCTGGGTGTTTG -3'
(R):5'- GTAAAAGTGATCAGCTTGCACTG -3'

Sequencing Primer
(F):5'- CATCATAGACTGTACTGTGAGGACTC -3'
(R):5'- TGAATGACAGCTCAAAGTCCTC -3'
Posted On2015-04-02