Incidental Mutation 'R3807:Adat1'
ID274980
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Nameadenosine deaminase, tRNA-specific 1
SynonymsmADAT1
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111966908-111992302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111990370 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000113201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000034427] [ENSMUST00000093120] [ENSMUST00000120457] [ENSMUST00000139820] [ENSMUST00000164470]
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034427
AA Change: W2R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120457
AA Change: W2R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139820
AA Change: W2R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 111982310 missense probably damaging 1.00
R0212:Adat1 UTSW 8 111987208 missense possibly damaging 0.50
R0559:Adat1 UTSW 8 111982430 missense probably damaging 1.00
R1521:Adat1 UTSW 8 111987235 missense possibly damaging 0.66
R1972:Adat1 UTSW 8 111990418 unclassified probably benign
R2217:Adat1 UTSW 8 111982496 missense probably benign 0.00
R4497:Adat1 UTSW 8 111979362 missense probably benign 0.06
R4553:Adat1 UTSW 8 111990280 missense probably damaging 1.00
R5702:Adat1 UTSW 8 111978072 missense probably benign 0.37
R5960:Adat1 UTSW 8 111982601 missense probably benign 0.00
R6380:Adat1 UTSW 8 111978072 missense probably benign 0.37
R6538:Adat1 UTSW 8 111968462 missense probably benign
R6907:Adat1 UTSW 8 111972161 missense probably benign
R7022:Adat1 UTSW 8 111989862 missense probably damaging 1.00
R7440:Adat1 UTSW 8 111989898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGGTTGCTGACAGGGAG -3'
(R):5'- CACTCTTCATTAAAGATGGGAAGG -3'

Sequencing Primer
(F):5'- AAGAAAGGGGCTCTCACCTTGC -3'
(R):5'- TCACTAGAGATGGCTGGA -3'
Posted On2015-04-02