Incidental Mutation 'R3807:Adat1'
ID 274980
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Name adenosine deaminase, tRNA-specific 1
Synonyms mADAT1
MMRRC Submission 040764-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R3807 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 112693540-112718934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112717002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000113201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000034427] [ENSMUST00000093120] [ENSMUST00000120457] [ENSMUST00000139820] [ENSMUST00000164470]
AlphaFold Q9JHI2
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034427
AA Change: W2R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120457
AA Change: W2R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139820
AA Change: W2R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949
AA Change: W2R

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A G 9: 9,008,034 (GRCm39) I563T probably damaging Het
Armcx1 T C X: 133,622,014 (GRCm39) V372A probably damaging Het
Bicd1 T A 6: 149,420,489 (GRCm39) L780M probably damaging Het
Bpifb1 C A 2: 154,055,922 (GRCm39) N329K probably benign Het
Ccdc113 A T 8: 96,269,281 (GRCm39) N193I probably damaging Het
Cebpz A T 17: 79,242,847 (GRCm39) L269Q probably damaging Het
Cttn C T 7: 143,999,588 (GRCm39) V290M probably damaging Het
Ctu1 T C 7: 43,326,097 (GRCm39) L252P probably damaging Het
Dmbt1 T A 7: 130,713,819 (GRCm39) M1455K possibly damaging Het
Eme1 A G 11: 94,541,418 (GRCm39) W135R probably damaging Het
Entpd7 T G 19: 43,713,979 (GRCm39) probably null Het
Eri2 A T 7: 119,385,231 (GRCm39) C423* probably null Het
Erich1 T C 8: 14,083,695 (GRCm39) N125S probably benign Het
Fam149a T A 8: 45,834,647 (GRCm39) T51S possibly damaging Het
Fer1l4 C T 2: 155,887,603 (GRCm39) G531D probably damaging Het
Frem2 A T 3: 53,560,870 (GRCm39) D1212E probably benign Het
Garin3 G A 11: 46,295,780 (GRCm39) A51T possibly damaging Het
Get4 G T 5: 139,238,286 (GRCm39) V23F probably damaging Het
Gm11595 C T 11: 99,663,380 (GRCm39) R100H unknown Het
Gria1 T C 11: 57,201,504 (GRCm39) W712R probably damaging Het
Herc2 A G 7: 55,857,557 (GRCm39) N4047D probably damaging Het
Hoxc9 A G 15: 102,890,116 (GRCm39) Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,066,661 (GRCm39) probably null Het
Lrrc56 A G 7: 140,789,298 (GRCm39) T393A probably benign Het
Lrrc7 T C 3: 157,891,130 (GRCm39) I346V probably benign Het
Med14 T C X: 12,553,416 (GRCm39) Y463C probably damaging Het
Nalcn T A 14: 123,515,599 (GRCm39) D1734V probably damaging Het
Nfe2l3 A T 6: 51,434,357 (GRCm39) R306* probably null Het
Nolc1 CAG CAGAAG 19: 46,069,798 (GRCm39) probably benign Het
Nolc1 CAG CAGAAG 19: 46,069,810 (GRCm39) probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,069,791 (GRCm39) probably benign Het
Npr1 A T 3: 90,366,033 (GRCm39) V586E probably damaging Het
Or2d2b A G 7: 106,705,670 (GRCm39) S133P probably benign Het
Or5h24 A C 16: 58,919,206 (GRCm39) *50G probably null Het
Pcdhb4 T C 18: 37,442,367 (GRCm39) F559S probably damaging Het
Psmd12 T G 11: 107,386,591 (GRCm39) D387E probably benign Het
Psme4 T A 11: 30,806,027 (GRCm39) probably null Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rgs11 A T 17: 26,422,474 (GRCm39) I69F probably damaging Het
Ryr1 C T 7: 28,719,577 (GRCm39) A4277T probably damaging Het
Setbp1 C T 18: 78,826,537 (GRCm39) V1359I probably benign Het
Sis A T 3: 72,832,929 (GRCm39) V956E probably benign Het
Slc35f3 T A 8: 127,115,978 (GRCm39) W302R probably damaging Het
Syt16 A G 12: 74,276,172 (GRCm39) E212G possibly damaging Het
Tdp2 C A 13: 25,015,776 (GRCm39) S21* probably null Het
Tfrc A T 16: 32,435,644 (GRCm39) N173I possibly damaging Het
Tmem132b A T 5: 125,864,644 (GRCm39) I917F probably damaging Het
Vbp1 T C X: 74,566,948 (GRCm39) V122A probably damaging Het
Vmn1r225 G A 17: 20,723,114 (GRCm39) W185* probably null Het
Vmn1r70 A G 7: 10,367,715 (GRCm39) T68A probably benign Het
Zfp518a A G 19: 40,903,241 (GRCm39) K1057E possibly damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 112,708,942 (GRCm39) missense probably damaging 1.00
R0212:Adat1 UTSW 8 112,713,840 (GRCm39) missense possibly damaging 0.50
R0559:Adat1 UTSW 8 112,709,062 (GRCm39) missense probably damaging 1.00
R1521:Adat1 UTSW 8 112,713,867 (GRCm39) missense possibly damaging 0.66
R1972:Adat1 UTSW 8 112,717,050 (GRCm39) unclassified probably benign
R2217:Adat1 UTSW 8 112,709,128 (GRCm39) missense probably benign 0.00
R4497:Adat1 UTSW 8 112,705,994 (GRCm39) missense probably benign 0.06
R4553:Adat1 UTSW 8 112,716,912 (GRCm39) missense probably damaging 1.00
R5702:Adat1 UTSW 8 112,704,704 (GRCm39) missense probably benign 0.37
R5960:Adat1 UTSW 8 112,709,233 (GRCm39) missense probably benign 0.00
R6380:Adat1 UTSW 8 112,704,704 (GRCm39) missense probably benign 0.37
R6538:Adat1 UTSW 8 112,695,094 (GRCm39) missense probably benign
R6907:Adat1 UTSW 8 112,698,793 (GRCm39) missense probably benign
R7022:Adat1 UTSW 8 112,716,494 (GRCm39) missense probably damaging 1.00
R7440:Adat1 UTSW 8 112,716,530 (GRCm39) missense probably damaging 0.99
R7606:Adat1 UTSW 8 112,709,236 (GRCm39) missense possibly damaging 0.50
R9581:Adat1 UTSW 8 112,705,946 (GRCm39) missense probably benign 0.29
R9592:Adat1 UTSW 8 112,709,314 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGGTTGCTGACAGGGAG -3'
(R):5'- CACTCTTCATTAAAGATGGGAAGG -3'

Sequencing Primer
(F):5'- AAGAAAGGGGCTCTCACCTTGC -3'
(R):5'- TCACTAGAGATGGCTGGA -3'
Posted On 2015-04-02