Mutagenetix > Incidental Mutations

Incidental Mutation 'R3807:Psme4'

274984

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

040764-MU

Accession Numbers

Genbank: NM_134013

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3807 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 30856027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114537 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably null
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000129824

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	A	T	8: 111,990,370	W2R	probably damaging	Het
Arhgap42	A	G	9: 9,008,033	I563T	probably damaging	Het
Armcx1	T	C	X: 134,721,265	V372A	probably damaging	Het
Bicd1	T	A	6: 149,518,991	L780M	probably damaging	Het
Bpifb1	C	A	2: 154,214,002	N329K	probably benign	Het
Ccdc113	A	T	8: 95,542,653	N193I	probably damaging	Het
Cebpz	A	T	17: 78,935,418	L269Q	probably damaging	Het
Cttn	C	T	7: 144,445,851	V290M	probably damaging	Het
Ctu1	T	C	7: 43,676,673	L252P	probably damaging	Het
Dmbt1	T	A	7: 131,112,090	M1455K	possibly damaging	Het
Eme1	A	G	11: 94,650,592	W135R	probably damaging	Het
Entpd7	T	G	19: 43,725,540		probably null	Het
Eri2	A	T	7: 119,786,008	C423*	probably null	Het
Erich1	T	C	8: 14,033,695	N125S	probably benign	Het
Fam149a	T	A	8: 45,381,610	T51S	possibly damaging	Het
Fam71b	G	A	11: 46,404,953	A51T	possibly damaging	Het
Fer1l4	C	T	2: 156,045,683	G531D	probably damaging	Het
Frem2	A	T	3: 53,653,449	D1212E	probably benign	Het
Get4	G	T	5: 139,252,531	V23F	probably damaging	Het
Gm11595	C	T	11: 99,772,554	R100H	unknown	Het
Gria1	T	C	11: 57,310,678	W712R	probably damaging	Het
Herc2	A	G	7: 56,207,809	N4047D	probably damaging	Het
Hoxc9	A	G	15: 102,981,684	Y11C	possibly damaging	Het
Lama2	GCCC	GCC	10: 27,190,665		probably null	Het
Lrrc56	A	G	7: 141,209,385	T393A	probably benign	Het
Lrrc7	T	C	3: 158,185,493	I346V	probably benign	Het
Med14	T	C	X: 12,687,177	Y463C	probably damaging	Het
Nalcn	T	A	14: 123,278,187	D1734V	probably damaging	Het
Nfe2l3	A	T	6: 51,457,377	R306*	probably null	Het
Nolc1	CCAGCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGCAGCAGCAGC	19: 46,081,352		probably benign	Het
Nolc1	CAG	CAGAAG	19: 46,081,359		probably benign	Het
Nolc1	CAG	CAGAAG	19: 46,081,371		probably benign	Het
Npr1	A	T	3: 90,458,726	V586E	probably damaging	Het
Olfr192	A	C	16: 59,098,843	*50G	probably null	Het
Olfr715b	A	G	7: 107,106,463	S133P	probably benign	Het
Pcdhb4	T	C	18: 37,309,314	F559S	probably damaging	Het
Psmd12	T	G	11: 107,495,765	D387E	probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rgs11	A	T	17: 26,203,500	I69F	probably damaging	Het
Ryr1	C	T	7: 29,020,152	A4277T	probably damaging	Het
Setbp1	C	T	18: 78,783,322	V1359I	probably benign	Het
Sis	A	T	3: 72,925,596	V956E	probably benign	Het
Slc35f3	T	A	8: 126,389,239	W302R	probably damaging	Het
Syt16	A	G	12: 74,229,398	E212G	possibly damaging	Het
Tdp2	C	A	13: 24,831,793	S21*	probably null	Het
Tfrc	A	T	16: 32,616,826	N173I	possibly damaging	Het
Tmem132b	A	T	5: 125,787,580	I917F	probably damaging	Het
Vbp1	T	C	X: 75,523,342	V122A	probably damaging	Het
Vmn1r225	G	A	17: 20,502,852	W185*	probably null	Het
Vmn1r70	A	G	7: 10,633,788	T68A	probably benign	Het
Zfp518a	A	G	19: 40,914,797	K1057E	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCAGAATTCTTGGCTAGTTTG -3'
(R):5'- TGTAGGTCCACACATCAACC -3'

Sequencing Primer
(F):5'- CTTGGCAGGCTATTATAACTCGTAG -3'
(R):5'- CAACCACTGAATGATGGTTACG -3'

Posted On

2015-04-02