Incidental Mutation 'R3807:Hoxc9'
ID274994
Institutional Source Beutler Lab
Gene Symbol Hoxc9
Ensembl Gene ENSMUSG00000036139
Gene Namehomeobox C9
SynonymsHox-3.2
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102976439-102985099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102981684 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 11 (Y11C)
Ref Sequence ENSEMBL: ENSMUSP00000001706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001706] [ENSMUST00000173306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001706
AA Change: Y11C

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001706
Gene: ENSMUSG00000036139
AA Change: Y11C

DomainStartEndE-ValueType
Pfam:Hox9_act 1 179 2e-63 PFAM
HOX 192 254 8.84e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene grow more slowly than normal and develop hunched backs. Forward transformations seen in vertebrae from L1 and forward to around T10. Abnormalities in the sternum and ribs attachments to the sternum are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Hoxc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL01418:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL03031:Hoxc9 APN 15 102984090 missense probably damaging 1.00
R0498:Hoxc9 UTSW 15 102983927 missense probably damaging 1.00
R1436:Hoxc9 UTSW 15 102981872 missense probably benign 0.03
R2059:Hoxc9 UTSW 15 102984123 missense probably benign 0.01
R2414:Hoxc9 UTSW 15 102984108 missense probably damaging 1.00
R2900:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R3821:Hoxc9 UTSW 15 102982164 missense probably benign 0.32
R4824:Hoxc9 UTSW 15 102981793 nonsense probably null
R5165:Hoxc9 UTSW 15 102984000 missense probably damaging 1.00
R5700:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R5701:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R6003:Hoxc9 UTSW 15 102981879 missense probably benign 0.15
R6145:Hoxc9 UTSW 15 102983959 missense probably damaging 1.00
R6570:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R7312:Hoxc9 UTSW 15 102982161 missense probably benign 0.02
R7434:Hoxc9 UTSW 15 102983982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCCCTGCGCATTGATC -3'
(R):5'- GATAGACCACAGACGACTGC -3'

Sequencing Primer
(F):5'- CGCGCCGTATTTTTGGGTAAATAC -3'
(R):5'- CACAGACGACTGCGAGGG -3'
Posted On2015-04-02