Incidental Mutation 'R3807:Cebpz'
ID274998
Institutional Source Beutler Lab
Gene Symbol Cebpz
Ensembl Gene ENSMUSG00000024081
Gene NameCCAAT/enhancer binding protein zeta
SynonymsCebpa-rs1, Cbf, CBF2
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R3807 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78919006-78937070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78935418 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 269 (L269Q)
Ref Sequence ENSEMBL: ENSMUSP00000024885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024885] [ENSMUST00000024887]
Predicted Effect probably damaging
Transcript: ENSMUST00000024885
AA Change: L269Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: L269Q

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
coiled coil region 113 143 N/A INTRINSIC
Pfam:CBF 523 732 5.7e-58 PFAM
low complexity region 834 851 N/A INTRINSIC
low complexity region 881 904 N/A INTRINSIC
low complexity region 957 969 N/A INTRINSIC
low complexity region 1028 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024887
SMART Domains Protein: ENSMUSP00000024887
Gene: ENSMUSG00000024082

DomainStartEndE-ValueType
Pfam:Methyltransf_28 95 349 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Armcx1 T C X: 134,721,265 V372A probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Other mutations in Cebpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Cebpz APN 17 78934830 missense probably damaging 1.00
IGL01558:Cebpz APN 17 78935305 missense probably damaging 1.00
IGL01724:Cebpz APN 17 78935913 missense probably benign 0.01
IGL01938:Cebpz APN 17 78934961 nonsense probably null
IGL02165:Cebpz APN 17 78922169 missense probably damaging 1.00
IGL02397:Cebpz APN 17 78923261 missense possibly damaging 0.63
IGL02455:Cebpz APN 17 78935036 missense probably benign 0.16
IGL02690:Cebpz APN 17 78922557 missense probably damaging 1.00
IGL02698:Cebpz APN 17 78935574 missense probably benign 0.03
IGL02755:Cebpz APN 17 78931330 missense probably damaging 1.00
IGL02827:Cebpz APN 17 78929331 missense probably damaging 1.00
IGL03149:Cebpz APN 17 78922553 missense probably benign 0.01
cedar_hill UTSW 17 78936910 missense possibly damaging 0.87
R0125:Cebpz UTSW 17 78919888 missense possibly damaging 0.95
R0138:Cebpz UTSW 17 78931391 missense probably benign
R0310:Cebpz UTSW 17 78926124 missense probably damaging 1.00
R0436:Cebpz UTSW 17 78935650 missense probably benign 0.00
R0589:Cebpz UTSW 17 78936879 missense probably damaging 1.00
R0828:Cebpz UTSW 17 78925982 missense probably benign 0.04
R1355:Cebpz UTSW 17 78935324 missense probably benign 0.01
R1367:Cebpz UTSW 17 78923313 missense probably benign
R1583:Cebpz UTSW 17 78934752 missense probably damaging 1.00
R1639:Cebpz UTSW 17 78934606 missense possibly damaging 0.49
R1818:Cebpz UTSW 17 78935376 missense probably damaging 1.00
R1885:Cebpz UTSW 17 78932116 missense probably benign 0.00
R1908:Cebpz UTSW 17 78934907 nonsense probably null
R1909:Cebpz UTSW 17 78934907 nonsense probably null
R2094:Cebpz UTSW 17 78935554 missense probably benign 0.03
R2314:Cebpz UTSW 17 78920547 critical splice donor site probably null
R2763:Cebpz UTSW 17 78935929 missense probably benign
R2874:Cebpz UTSW 17 78932103 splice site probably benign
R4012:Cebpz UTSW 17 78924467 missense probably damaging 0.98
R5344:Cebpz UTSW 17 78926113 missense possibly damaging 0.82
R5394:Cebpz UTSW 17 78922205 missense probably benign 0.34
R5711:Cebpz UTSW 17 78934611 missense probably damaging 1.00
R5902:Cebpz UTSW 17 78925937 missense probably benign 0.20
R6238:Cebpz UTSW 17 78936910 missense possibly damaging 0.87
R6257:Cebpz UTSW 17 78935832 missense probably benign 0.17
R6825:Cebpz UTSW 17 78919963 missense probably damaging 1.00
R7735:Cebpz UTSW 17 78925913 critical splice donor site probably null
R8045:Cebpz UTSW 17 78932156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCCTTGTTGCCACTGGAC -3'
(R):5'- ACAGCGGTGAGTATTCCTTG -3'

Sequencing Primer
(F):5'- GACAACTCTTCCAGTTTGTGG -3'
(R):5'- TGTCGTGTCCAAGTACAAAGC -3'
Posted On2015-04-02