Incidental Mutation 'R3807:Nolc1'
ID 275004
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Name nucleolar and coiled-body phosphoprotein 1
Synonyms 3230402K17Rik, P130, NOPP140
MMRRC Submission 040764-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3807 (G1)
Quality Score 142
Status Not validated
Chromosome 19
Chromosomal Location 46064302-46073969 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGAAG at 46069798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000225780] [ENSMUST00000224490]
AlphaFold E9Q5C9
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 112,717,002 (GRCm39) W2R probably damaging Het
Arhgap42 A G 9: 9,008,034 (GRCm39) I563T probably damaging Het
Armcx1 T C X: 133,622,014 (GRCm39) V372A probably damaging Het
Bicd1 T A 6: 149,420,489 (GRCm39) L780M probably damaging Het
Bpifb1 C A 2: 154,055,922 (GRCm39) N329K probably benign Het
Ccdc113 A T 8: 96,269,281 (GRCm39) N193I probably damaging Het
Cebpz A T 17: 79,242,847 (GRCm39) L269Q probably damaging Het
Cttn C T 7: 143,999,588 (GRCm39) V290M probably damaging Het
Ctu1 T C 7: 43,326,097 (GRCm39) L252P probably damaging Het
Dmbt1 T A 7: 130,713,819 (GRCm39) M1455K possibly damaging Het
Eme1 A G 11: 94,541,418 (GRCm39) W135R probably damaging Het
Entpd7 T G 19: 43,713,979 (GRCm39) probably null Het
Eri2 A T 7: 119,385,231 (GRCm39) C423* probably null Het
Erich1 T C 8: 14,083,695 (GRCm39) N125S probably benign Het
Fam149a T A 8: 45,834,647 (GRCm39) T51S possibly damaging Het
Fer1l4 C T 2: 155,887,603 (GRCm39) G531D probably damaging Het
Frem2 A T 3: 53,560,870 (GRCm39) D1212E probably benign Het
Garin3 G A 11: 46,295,780 (GRCm39) A51T possibly damaging Het
Get4 G T 5: 139,238,286 (GRCm39) V23F probably damaging Het
Gm11595 C T 11: 99,663,380 (GRCm39) R100H unknown Het
Gria1 T C 11: 57,201,504 (GRCm39) W712R probably damaging Het
Herc2 A G 7: 55,857,557 (GRCm39) N4047D probably damaging Het
Hoxc9 A G 15: 102,890,116 (GRCm39) Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,066,661 (GRCm39) probably null Het
Lrrc56 A G 7: 140,789,298 (GRCm39) T393A probably benign Het
Lrrc7 T C 3: 157,891,130 (GRCm39) I346V probably benign Het
Med14 T C X: 12,553,416 (GRCm39) Y463C probably damaging Het
Nalcn T A 14: 123,515,599 (GRCm39) D1734V probably damaging Het
Nfe2l3 A T 6: 51,434,357 (GRCm39) R306* probably null Het
Npr1 A T 3: 90,366,033 (GRCm39) V586E probably damaging Het
Or2d2b A G 7: 106,705,670 (GRCm39) S133P probably benign Het
Or5h24 A C 16: 58,919,206 (GRCm39) *50G probably null Het
Pcdhb4 T C 18: 37,442,367 (GRCm39) F559S probably damaging Het
Psmd12 T G 11: 107,386,591 (GRCm39) D387E probably benign Het
Psme4 T A 11: 30,806,027 (GRCm39) probably null Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rgs11 A T 17: 26,422,474 (GRCm39) I69F probably damaging Het
Ryr1 C T 7: 28,719,577 (GRCm39) A4277T probably damaging Het
Setbp1 C T 18: 78,826,537 (GRCm39) V1359I probably benign Het
Sis A T 3: 72,832,929 (GRCm39) V956E probably benign Het
Slc35f3 T A 8: 127,115,978 (GRCm39) W302R probably damaging Het
Syt16 A G 12: 74,276,172 (GRCm39) E212G possibly damaging Het
Tdp2 C A 13: 25,015,776 (GRCm39) S21* probably null Het
Tfrc A T 16: 32,435,644 (GRCm39) N173I possibly damaging Het
Tmem132b A T 5: 125,864,644 (GRCm39) I917F probably damaging Het
Vbp1 T C X: 74,566,948 (GRCm39) V122A probably damaging Het
Vmn1r225 G A 17: 20,723,114 (GRCm39) W185* probably null Het
Vmn1r70 A G 7: 10,367,715 (GRCm39) T68A probably benign Het
Zfp518a A G 19: 40,903,241 (GRCm39) K1057E possibly damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46,071,468 (GRCm39) unclassified probably benign
FR4976:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
FR4976:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R0106:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R0121:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0140:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0501:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46,072,598 (GRCm39) missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R1553:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
R1642:Nolc1 UTSW 19 46,067,461 (GRCm39) critical splice donor site probably null
R1698:Nolc1 UTSW 19 46,069,870 (GRCm39) splice site probably null
R2067:Nolc1 UTSW 19 46,072,046 (GRCm39) missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46,069,800 (GRCm39) small insertion probably benign
R2113:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,807 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2895:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R2999:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R3737:Nolc1 UTSW 19 46,069,816 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,792 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,809 (GRCm39) small insertion probably benign
R3747:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R3806:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
R4035:Nolc1 UTSW 19 46,069,797 (GRCm39) small insertion probably benign
R4619:Nolc1 UTSW 19 46,071,959 (GRCm39) missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R4999:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46,070,103 (GRCm39) nonsense probably null
R5559:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R5837:Nolc1 UTSW 19 46,071,622 (GRCm39) unclassified probably benign
R6457:Nolc1 UTSW 19 46,071,509 (GRCm39) unclassified probably benign
R7467:Nolc1 UTSW 19 46,070,773 (GRCm39) missense unknown
R7497:Nolc1 UTSW 19 46,071,257 (GRCm39) missense probably benign 0.23
R8011:Nolc1 UTSW 19 46,070,023 (GRCm39) missense unknown
R8806:Nolc1 UTSW 19 46,071,471 (GRCm39) missense unknown
RF027:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF031:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF034:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF040:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF044:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
X0050:Nolc1 UTSW 19 46,069,791 (GRCm39) small deletion probably benign
Y5377:Nolc1 UTSW 19 46,069,808 (GRCm39) small insertion probably benign
Y5379:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
Z1088:Nolc1 UTSW 19 46,071,537 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATCTAGGCATCTCACTCAGG -3'
(R):5'- TGGTACAGTCTTCATTGGAGAG -3'

Sequencing Primer
(F):5'- AGGCATCTCACTCAGGTCATC -3'
(R):5'- GAAAATTAACATTAGAGGAAAGCGCC -3'
Posted On 2015-04-02