Incidental Mutation 'R3807:Armcx1'
ID275008
Institutional Source Beutler Lab
Gene Symbol Armcx1
Ensembl Gene ENSMUSG00000033460
Gene Namearmadillo repeat containing, X-linked 1
Synonyms3010033I09Rik
MMRRC Submission 040764-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3807 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location134717963-134721917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134721265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 372 (V372A)
Ref Sequence ENSEMBL: ENSMUSP00000108826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035748] [ENSMUST00000051256] [ENSMUST00000113197] [ENSMUST00000113198] [ENSMUST00000113199] [ENSMUST00000113201]
Predicted Effect probably damaging
Transcript: ENSMUST00000035748
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043965
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 7.7e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051256
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053909
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 7.7e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113197
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108822
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 7.7e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113198
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108823
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 7.7e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113199
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108824
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 7.7e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113201
AA Change: V372A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108826
Gene: ENSMUSG00000033460
AA Change: V372A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 31 60 N/A INTRINSIC
low complexity region 143 163 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Pfam:Arm_2 197 450 1.4e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and two Armadillo (arm) repeats. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX2 and ALEX3, on the X chromosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A T 8: 111,990,370 W2R probably damaging Het
Arhgap42 A G 9: 9,008,033 I563T probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Bpifb1 C A 2: 154,214,002 N329K probably benign Het
Ccdc113 A T 8: 95,542,653 N193I probably damaging Het
Cebpz A T 17: 78,935,418 L269Q probably damaging Het
Cttn C T 7: 144,445,851 V290M probably damaging Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dmbt1 T A 7: 131,112,090 M1455K possibly damaging Het
Eme1 A G 11: 94,650,592 W135R probably damaging Het
Entpd7 T G 19: 43,725,540 probably null Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Erich1 T C 8: 14,033,695 N125S probably benign Het
Fam149a T A 8: 45,381,610 T51S possibly damaging Het
Fam71b G A 11: 46,404,953 A51T possibly damaging Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Frem2 A T 3: 53,653,449 D1212E probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Gm11595 C T 11: 99,772,554 R100H unknown Het
Gria1 T C 11: 57,310,678 W712R probably damaging Het
Herc2 A G 7: 56,207,809 N4047D probably damaging Het
Hoxc9 A G 15: 102,981,684 Y11C possibly damaging Het
Lama2 GCCC GCC 10: 27,190,665 probably null Het
Lrrc56 A G 7: 141,209,385 T393A probably benign Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Med14 T C X: 12,687,177 Y463C probably damaging Het
Nalcn T A 14: 123,278,187 D1734V probably damaging Het
Nfe2l3 A T 6: 51,457,377 R306* probably null Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGAAG 19: 46,081,371 probably benign Het
Npr1 A T 3: 90,458,726 V586E probably damaging Het
Olfr192 A C 16: 59,098,843 *50G probably null Het
Olfr715b A G 7: 107,106,463 S133P probably benign Het
Pcdhb4 T C 18: 37,309,314 F559S probably damaging Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Psme4 T A 11: 30,856,027 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rgs11 A T 17: 26,203,500 I69F probably damaging Het
Ryr1 C T 7: 29,020,152 A4277T probably damaging Het
Setbp1 C T 18: 78,783,322 V1359I probably benign Het
Sis A T 3: 72,925,596 V956E probably benign Het
Slc35f3 T A 8: 126,389,239 W302R probably damaging Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Tdp2 C A 13: 24,831,793 S21* probably null Het
Tfrc A T 16: 32,616,826 N173I possibly damaging Het
Tmem132b A T 5: 125,787,580 I917F probably damaging Het
Vbp1 T C X: 75,523,342 V122A probably damaging Het
Vmn1r225 G A 17: 20,502,852 W185* probably null Het
Vmn1r70 A G 7: 10,633,788 T68A probably benign Het
Zfp518a A G 19: 40,914,797 K1057E possibly damaging Het
Predicted Primers PCR Primer
(F):5'- GCTGGATTAAGACTCCTTACCAAC -3'
(R):5'- CACCAGATCCTTATGGCTTGC -3'

Sequencing Primer
(F):5'- TTAAGACTCCTTACCAACATGACTG -3'
(R):5'- ACCAGATCCTTATGGCTTGCTAATG -3'
Posted On2015-04-02