Incidental Mutation 'R3808:Lin9'
ID275015
Institutional Source Beutler Lab
Gene Symbol Lin9
Ensembl Gene ENSMUSG00000058729
Gene Namelin-9 homolog (C. elegans)
Synonyms2700022J23Rik
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180641150-180690694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180659111 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 81 (I81V)
Ref Sequence ENSEMBL: ENSMUSP00000141503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably null
Transcript: ENSMUST00000085803
AA Change: I105V

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: I105V

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085804
SMART Domains Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191744
Predicted Effect probably null
Transcript: ENSMUST00000192561
AA Change: I121V

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: I121V

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192725
AA Change: I81V

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: I81V

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192725
AA Change: I81V

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: I81V

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
AA Change: I105V

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729
AA Change: I105V

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194638
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Lin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Lin9 APN 1 180667367 missense probably damaging 1.00
IGL02221:Lin9 APN 1 180650834 missense probably benign 0.03
IGL02233:Lin9 APN 1 180689300 missense probably damaging 0.98
IGL02370:Lin9 APN 1 180688018 missense probably damaging 1.00
IGL02794:Lin9 APN 1 180651879 missense probably damaging 1.00
R0278:Lin9 UTSW 1 180665923 missense probably damaging 1.00
R1488:Lin9 UTSW 1 180688285 missense possibly damaging 0.61
R3809:Lin9 UTSW 1 180659111 missense probably null 0.32
R3884:Lin9 UTSW 1 180688065 nonsense probably null
R3978:Lin9 UTSW 1 180668792 missense possibly damaging 0.94
R4600:Lin9 UTSW 1 180681194 missense probably damaging 0.99
R4625:Lin9 UTSW 1 180689280 missense probably damaging 0.99
R4730:Lin9 UTSW 1 180665851 nonsense probably null
R4987:Lin9 UTSW 1 180668764 missense probably damaging 1.00
R5034:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5035:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5045:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5046:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5148:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5180:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5181:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5221:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5222:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5329:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5332:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5633:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5634:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5696:Lin9 UTSW 1 180659081 missense probably benign 0.00
R5812:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5813:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5814:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5851:Lin9 UTSW 1 180669198 missense probably benign 0.01
R7046:Lin9 UTSW 1 180667370 missense probably damaging 1.00
R7084:Lin9 UTSW 1 180688096 missense probably benign 0.11
Z1177:Lin9 UTSW 1 180650802 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GAGCACTTAAATATGCCCTATCTC -3'
(R):5'- TACAGAAGAGGTGACAGCTTATAAC -3'

Sequencing Primer
(F):5'- GGCTGGCCTTGAACTCAGAAATTC -3'
(R):5'- GAAGAGGTGACAGCTTATAACATTTG -3'
Posted On2015-04-02