Incidental Mutation 'R3808:Rassf2'
ID275022
Institutional Source Beutler Lab
Gene Symbol Rassf2
Ensembl Gene ENSMUSG00000027339
Gene NameRas association (RalGDS/AF-6) domain family member 2
Synonyms
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3808 (G1)
Quality Score218
Status Not validated
Chromosome2
Chromosomal Location131989415-132030258 bp(-) (GRCm38)
Type of Mutationsplice site (4654 bp from exon)
DNA Base Change (assembly) T to C at 131998260 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028814] [ENSMUST00000103182] [ENSMUST00000139047]
Predicted Effect probably benign
Transcript: ENSMUST00000028814
AA Change: E299G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028814
Gene: ENSMUSG00000027339
AA Change: E299G

DomainStartEndE-ValueType
RA 174 265 5.33e-18 SMART
coiled coil region 292 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103182
AA Change: E299G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099471
Gene: ENSMUSG00000027339
AA Change: E299G

DomainStartEndE-ValueType
RA 174 265 5.33e-18 SMART
Pfam:Nore1-SARAH 277 316 3.9e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139047
SMART Domains Protein: ENSMUSP00000120194
Gene: ENSMUSG00000027339

DomainStartEndE-ValueType
Blast:RA 174 202 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155829
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a Ras association domain. Similar to its cattle and sheep counterparts, this gene is located near the prion gene. Two alternatively spliced transcripts encoding the same isoform have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone defects and hematopoeitic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Rassf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Rassf2 APN 2 132000432 critical splice donor site probably null
IGL02142:Rassf2 APN 2 131996433 missense possibly damaging 0.69
IGL02694:Rassf2 APN 2 132009721 missense possibly damaging 0.91
IGL02727:Rassf2 APN 2 132004387 missense probably benign 0.11
R0722:Rassf2 UTSW 2 132002910 missense probably damaging 1.00
R2326:Rassf2 UTSW 2 132000432 critical splice donor site probably null
R2508:Rassf2 UTSW 2 131998243 critical splice donor site probably null
R3809:Rassf2 UTSW 2 131998260 splice site probably null
R4077:Rassf2 UTSW 2 132012602 missense probably benign
R4085:Rassf2 UTSW 2 132004379 missense probably damaging 1.00
R4285:Rassf2 UTSW 2 132005394 missense probably benign 0.17
R4721:Rassf2 UTSW 2 132004438 missense probably benign
R4762:Rassf2 UTSW 2 132002863 unclassified probably benign
R5012:Rassf2 UTSW 2 132009690 missense probably damaging 1.00
R6545:Rassf2 UTSW 2 131998317 missense probably damaging 0.98
R6788:Rassf2 UTSW 2 132002925 missense probably damaging 1.00
R7232:Rassf2 UTSW 2 131996412 missense probably damaging 1.00
R7711:Rassf2 UTSW 2 132005377 missense probably benign 0.04
X0063:Rassf2 UTSW 2 131998254 missense probably damaging 1.00
Z1177:Rassf2 UTSW 2 132004369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCCTGTCTGAGATCTGG -3'
(R):5'- CTCATGCAGATGTGACCAGC -3'

Sequencing Primer
(F):5'- AGATCTGGGTCTGTCAGTGGAC -3'
(R):5'- AGATGTGACCAGCCTGGGAC -3'
Posted On2015-04-02